Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003882.1

Orthogroup ID

OG0022642

Physical Location & Seq

Genomic Coordinates Reverse (-)

42614 .. 43222

Gene Structure 609 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003882.1_g000012.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 609 bp

atggaggttgacgaaagtagctttgggattcttgttaacagcttctacgaacttgaactagaatatgcaaatcactataggaaggtgtttgggaggaagtcagggcatatcagcccaatttctttatgcaacaaggcagaagaagataaatcagcgaggggagaggaaggctctgctgatggagtacatgaatgctttgattggcttaatactaaggaacccaattcggttgtttatacatgctttggaagccttaccaatttcagtgatgctctgcttgtaaaaattgccttggctcttgagtcttctcatcagcaattcatttgggttgtcaggaaagaaaagaatgataaaggagagtggttgcctgatgaaggatttgagcagaggttagaagataagggactaataataagtggttgggctccccaactactaattcttgaacatgaagcagttggggcctttatgactcattgtggttggaactctatccttaaaggagtggctgctggggtgccaatgatcacatggccagtgtccgcagagcaattctacaatgagaagttggtgactcagttgcttgggattagggttgctgggatttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00906 ko01100 ko01110 map00906 map01100 map01110

Pfam Domains

Protein Families

UDPGT

Protein Analysis

202

Amino Acids

22.61

Weight (kDa)

4.99

Isoelectric Point (pI)

30.13

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022642)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0104251 RchiOBHm_Chr2g0104301 RchiOBHm_Chr6g0257751
rosa_multiflora	Rmu_sc0003882.1_g000012

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	517
AciI	CCGC	1 cut(s)	543
AcoI	YGGCCR	1 cut(s)	533
AfaI	GTAC	1 cut(s)	186
AfiI	CCNNNNNNNGG	1 cut(s)	374
AgsI	TTSAA	2 cut(s)	56, 446
AjuI	GAANNNNNNNTTGG	3 cut(s)	38, 423, 455
AluBI	AGCT	2 cut(s)	21, 42
AluI	AGCT	2 cut(s)	21, 42
AoxI	GGCC	2 cut(s)	462, 533
ApeKI	GCWGC	1 cut(s)	509
AspS9I	GGNCC	1 cut(s)	462
AsuHPI	GGTGA	1 cut(s)	583
BalI	TGGCCA	1 cut(s)	535
BanI	GGYRCC	1 cut(s)	517
BanII	GRGCYC	1 cut(s)	427
BbsI	GAAGAC	1 cut(s)	297
BbvI	GCAGC	1 cut(s)	496
BccI	CCATC	1 cut(s)	173
BclI	TGATCA	1 cut(s)	525
BfaI	CTAG	1 cut(s)	59
BfmI	CTRYAG	1 cut(s)	76
BisI	GCNGC	1 cut(s)	510
BlsI	GCNGC	1 cut(s)	511
BmgT120I	GGNCC	1 cut(s)	462
BmiI	GGNNCC	4 cut(s)	219, 426, 463, 519
BmsI	GCATC	1 cut(s)	259
BpiI	GAAGAC	1 cut(s)	297
BplI	GAGNNNNNCTC	2 cut(s)	155, 187
BpuEI	CTTGAG	1 cut(s)	320
BsaJI	CCNNGG	1 cut(s)	291
Bsc4I	CCNNNNNNNGG	1 cut(s)	374
Bse1I	ACTGG	1 cut(s)	536
BseDI	CCNNGG	1 cut(s)	291
BseLI	CCNNNNNNNGG	1 cut(s)	374
BseMII	CTCAG	1 cut(s)	590
BseNI	ACTGG	1 cut(s)	536
BseXI	GCAGC	1 cut(s)	496
BseYI	CCCAGC	2 cut(s)	512, 599
BshFI	GGCC	2 cut(s)	464, 535
BshNI	GGYRCC	1 cut(s)	517
BslFI	GGGAC	1 cut(s)	417
BslI	CCNNNNNNNGG	1 cut(s)	374
BsmFI	GGGAC	1 cut(s)	417
BsmI	GAATGC	1 cut(s)	197
BsnI	GGCC	2 cut(s)	464, 535
Bsp1286I	GDGCHC	1 cut(s)	427
Bsp143I	GATC	1 cut(s)	525
BspACI	CCGC	1 cut(s)	543
BspANI	GGCC	2 cut(s)	464, 535
BspCNI	CTCAG	1 cut(s)	589
BspLI	GGNNCC	4 cut(s)	219, 426, 463, 519
BspT107I	GGYRCC	1 cut(s)	517
BsrI	ACTGG	1 cut(s)	536
BssECI	CCNNGG	1 cut(s)	291
BssMI	GATC	1 cut(s)	525
BssT1I	CCWWGG	1 cut(s)	291
BstDEI	CTNAG	2 cut(s)	213, 576
BstENI	CCTNNNNNAGG	1 cut(s)	372
BstKTI	GATC	1 cut(s)	528
BstMBI	GATC	1 cut(s)	525
BstMWI	GCNNNNNNNGC	2 cut(s)	249, 461
BstNSI	RCATGY	1 cut(s)	243
BstSFI	CTRYAG	1 cut(s)	76
BstV1I	GCAGC	1 cut(s)	496
BstV2I	GAAGAC	1 cut(s)	297
BsuRI	GGCC	2 cut(s)	464, 535
BtsIMutI	CAGTG	2 cut(s)	271, 543
Cfr13I	GGNCC	1 cut(s)	462
Csp6I	GTAC	1 cut(s)	185
CviAII	CATG	4 cut(s)	188, 240, 449, 531
CviQI	GTAC	1 cut(s)	185
DdeI	CTNAG	2 cut(s)	213, 576
DpnI	GATC	1 cut(s)	527
DpnII	GATC	1 cut(s)	525
EaeI	YGGCCR	1 cut(s)	533
Eco130I	CCWWGG	1 cut(s)	291
Eco24I	GRGCYC	1 cut(s)	427
EcoNI	CCTNNNNNAGG	1 cut(s)	372
EcoO109I	RGGNCCY	1 cut(s)	462
EcoT14I	CCWWGG	1 cut(s)	291
EcoT38I	GRGCYC	1 cut(s)	427
ErhI	CCWWGG	1 cut(s)	291
FaeI	CATG	4 cut(s)	191, 243, 452, 534
FaqI	GGGAC	1 cut(s)	417
FatI	CATG	4 cut(s)	187, 239, 448, 530
FbaI	TGATCA	1 cut(s)	525
Fnu4HI	GCNGC	1 cut(s)	510
FriOI	GRGCYC	1 cut(s)	427
Fsp4HI	GCNGC	1 cut(s)	510
FspBI	CTAG	1 cut(s)	59
GluI	GCNGC	1 cut(s)	510
GsaI	CCCAGC	2 cut(s)	516, 603
HaeIII	GGCC	2 cut(s)	464, 535
Hin1II	CATG	4 cut(s)	191, 243, 452, 534
HincII	GTYRAC	2 cut(s)	10, 37
HindII	GTYRAC	2 cut(s)	10, 37
HinfI	GANTC	4 cut(s)	28, 302, 472, 574
HpaI	GTTAAC	1 cut(s)	37
HphI	GGTGA	1 cut(s)	583
Hpy166II	GTNNAC	2 cut(s)	10, 37
Hpy188III	TCNNGA	3 cut(s)	299, 334, 443
Hpy8I	GTNNAC	2 cut(s)	10, 37
HpyAV	CCTTC	3 cut(s)	76, 161, 368
HpyCH4V	TGCA	2 cut(s)	68, 129
HpyF10VI	GCNNNNNNNGC	2 cut(s)	249, 461
HpyF3I	CTNAG	2 cut(s)	213, 576
Hsp92II	CATG	4 cut(s)	191, 243, 452, 534
Ksp22I	TGATCA	1 cut(s)	525
KspAI	GTTAAC	1 cut(s)	37
Kzo9I	GATC	1 cut(s)	525
LmnI	GCTCC	1 cut(s)	430
LpnPI	CCDG	6 cut(s)	87, 319, 381, 498, 549, 585
Lsp1109I	GCAGC	1 cut(s)	496
LweI	GCATC	1 cut(s)	259
MaeI	CTAG	1 cut(s)	59
MaeIII	GTNAC	1 cut(s)	571
MalI	GATC	1 cut(s)	527
MboI	GATC	1 cut(s)	525
MboII	GAAGA	4 cut(s)	152, 155, 297, 407
MhlI	GDGCHC	1 cut(s)	427
MlsI	TGGCCA	1 cut(s)	535
MluCI	AATT	7 cut(s)	117, 223, 259, 285, 317, 438, 551
MluNI	TGGCCA	1 cut(s)	535
MlyI	GAGTC	3 cut(s)	311, 466, 568
MmeI	TCCRAC	1 cut(s)	464
MnlI	CCTC	4 cut(s)	87, 150, 157, 381
Mox20I	TGGCCA	1 cut(s)	535
MscI	TGGCCA	1 cut(s)	535
MseI	TTAA	3 cut(s)	36, 207, 498
Msp20I	TGGCCA	1 cut(s)	535
Mva1269I	GAATGC	1 cut(s)	197
MwoI	GCNNNNNNNGC	2 cut(s)	249, 461
NdeII	GATC	1 cut(s)	525
NlaIII	CATG	4 cut(s)	191, 243, 452, 534
NlaIV	GGNNCC	4 cut(s)	219, 426, 463, 519
NmuCI	GTSAC	1 cut(s)	571
NspI	RCATGY	1 cut(s)	243
PctI	GAATGC	1 cut(s)	197
PfeI	GAWTC	1 cut(s)	28
PkrI	GCNGC	1 cut(s)	511
PleI	GAGTC	3 cut(s)	310, 466, 568
PpsI	GAGTC	3 cut(s)	310, 466, 568
PspFI	CCCAGC	2 cut(s)	512, 599
PspN4I	GGNNCC	4 cut(s)	219, 426, 463, 519
PspPI	GGNCC	1 cut(s)	462
RsaI	GTAC	1 cut(s)	186
RsaNI	GTAC	1 cut(s)	185
SaqAI	TTAA	3 cut(s)	36, 207, 498
SatI	GCNGC	1 cut(s)	510
Sau3AI	GATC	1 cut(s)	525
Sau96I	GGNCC	1 cut(s)	462
SchI	GAGTC	3 cut(s)	311, 466, 568
SduI	GDGCHC	1 cut(s)	427
SetI	ASST	5 cut(s)	9, 23, 44, 87, 392
SfaNI	GCATC	1 cut(s)	259
SfcI	CTRYAG	1 cut(s)	76
SmlI	CTYRAG	1 cut(s)	299
SmoI	CTYRAG	1 cut(s)	299
Sse9I	AATT	7 cut(s)	117, 223, 259, 285, 317, 438, 551
SsiI	CCGC	1 cut(s)	543
SspMI	CTAG	1 cut(s)	59
StyI	CCWWGG	1 cut(s)	291
TasI	AATT	7 cut(s)	117, 223, 259, 285, 317, 438, 551
TatI	WGTACW	1 cut(s)	184
TfiI	GAWTC	1 cut(s)	28
Tru1I	TTAA	3 cut(s)	36, 207, 498
Tru9I	TTAA	3 cut(s)	36, 207, 498
TscAI	CASTG	2 cut(s)	271, 543
TseFI	GTSAC	1 cut(s)	571
TseI	GCWGC	1 cut(s)	509
Tsp45I	GTSAC	1 cut(s)	571
TspDTI	ATGAA	4 cut(s)	204, 310, 387, 465
TspRI	CASTG	2 cut(s)	271, 543
XagI	CCTNNNNNAGG	1 cut(s)	372
XceI	RCATGY	1 cut(s)	243
XcmI	CCANNNNNNNNNTGG	1 cut(s)	528
XspI	CTAG	1 cut(s)	59

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.