Rmu_sc0003977.1_g000014

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003977.1
OG0025574
Physical Location & Seq
Reverse (-)
87244 .. 87510
267 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003977.1_g000014.1.cds

Sequence Viewer

Length: 267 bp
atgccttcccggcaacccttgagcttccgctcatgcctccccggcaacccacgagcttcccgctcatgccttcccggcaccccgagcttcctctcatgccttcccggcaatcctggagcttccgctcatgcctccccggcaacccacgagcttcccgctcatgccttcccggcaatcccgagtttccctttcacgagctttccgcacatgcctttccggcaatcctcgagctttacactcatgtctactcgacaaaccacacgttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.45

Weight (kDa)

11.6

Isoelectric Point (pI)

105.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025574)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0003977.1_g000014 Rmu_sc0004275.1_g000017 Rmu_sc0005821.1_g000005

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 77
AccBSI CCGCTC 4 cut(s) 30, 63, 125, 158
AccI GTMKAC 1 cut(s) 245
AciI CCGC 5 cut(s) 28, 61, 123, 156, 203
AflIII ACRYGT 1 cut(s) 260
AjnI CCWGG 1 cut(s) 112
AluBI AGCT 7 cut(s) 24, 56, 87, 119, 151, 198, 231
AluI AGCT 7 cut(s) 24, 56, 87, 119, 151, 198, 231
Ama87I CYCGRG 3 cut(s) 82, 178, 226
AsuC2I CCSGG 6 cut(s) 10, 42, 75, 105, 137, 170
AvaI CYCGRG 3 cut(s) 82, 178, 226
BanI GGYRCC 1 cut(s) 77
BauI CACGAG 3 cut(s) 51, 146, 193
BciT130I CCWGG 1 cut(s) 114
BcnI CCSGG 6 cut(s) 10, 42, 75, 105, 137, 170
BglI GCCNNNNNGGC 7 cut(s) 10, 42, 75, 105, 137, 170, 217
Bme1390I CCNGG 7 cut(s) 10, 42, 75, 105, 114, 137, 170
BmeT110I CYCGRG 3 cut(s) 82, 178, 226
BmiI GGNNCC 1 cut(s) 79
BmrFI CCNGG 7 cut(s) 10, 42, 75, 105, 114, 137, 170
BpmI CTGGAG 1 cut(s) 135
BpuEI CTTGAG 1 cut(s) 40
BpuMI CCSGG 6 cut(s) 10, 42, 75, 105, 137, 170
BsaJI CCNNGG 2 cut(s) 40, 135
BseBI CCWGG 1 cut(s) 114
BseDI CCNNGG 2 cut(s) 40, 135
BshNI GGYRCC 1 cut(s) 77
BsiHKCI CYCGRG 3 cut(s) 82, 178, 226
BsiSI CCGG 7 cut(s) 10, 42, 75, 105, 137, 170, 217
BsoBI CYCGRG 3 cut(s) 82, 178, 226
BspACI CCGC 5 cut(s) 28, 61, 123, 156, 203
BspLI GGNNCC 1 cut(s) 79
BspT107I GGYRCC 1 cut(s) 77
BsrBI CCGCTC 4 cut(s) 30, 63, 125, 158
BssECI CCNNGG 2 cut(s) 40, 135
BssSI CACGAG 3 cut(s) 51, 146, 193
Bst2BI CACGAG 3 cut(s) 51, 146, 193
Bst2UI CCWGG 1 cut(s) 114
BstMWI GCNNNNNNNGC 8 cut(s) 10, 42, 75, 84, 105, 137, 170, 217
BstNI CCWGG 1 cut(s) 114
BstNSI RCATGY 1 cut(s) 211
BstSCI CCNGG 7 cut(s) 8, 40, 73, 103, 112, 135, 168
CviAII CATG 7 cut(s) 33, 66, 96, 128, 161, 208, 241
CviJI RGCY 7 cut(s) 24, 56, 87, 119, 151, 198, 231
CviKI_1 RGCY 7 cut(s) 24, 56, 87, 119, 151, 198, 231
Eco88I CYCGRG 3 cut(s) 82, 178, 226
EcoRII CCWGG 1 cut(s) 112
FaeI CATG 7 cut(s) 36, 69, 99, 131, 164, 211, 244
FaiI YATR 7 cut(s) 34, 67, 97, 129, 162, 209, 242
FatI CATG 7 cut(s) 32, 65, 95, 127, 160, 207, 240
FauI CCCGC 2 cut(s) 68, 163
FblI GTMKAC 1 cut(s) 245
GsuI CTGGAG 1 cut(s) 135
HapII CCGG 7 cut(s) 10, 42, 75, 105, 137, 170, 217
Hin1II CATG 7 cut(s) 36, 69, 99, 131, 164, 211, 244
HpaII CCGG 7 cut(s) 10, 42, 75, 105, 137, 170, 217
Hpy166II GTNNAC 1 cut(s) 246
Hpy188III TCNNGA 2 cut(s) 178, 193
Hpy8I GTNNAC 1 cut(s) 246
HpyAV CCTTC 4 cut(s) 15, 80, 110, 175
HpyCH4IV ACGT 1 cut(s) 262
HpyF10VI GCNNNNNNNGC 8 cut(s) 10, 42, 75, 84, 105, 137, 170, 217
HpySE526I ACGT 1 cut(s) 262
Hsp92II CATG 7 cut(s) 36, 69, 99, 131, 164, 211, 244
LmnI GCTCC 1 cut(s) 116
LpnPI CCDG 9 cut(s) 23, 55, 88, 99, 118, 126, 150, 183, 230
MaeII ACGT 1 cut(s) 262
MbiI CCGCTC 4 cut(s) 30, 63, 125, 158
MnlI CCTC 4 cut(s) 47, 101, 142, 235
MseI TTAA 1 cut(s) 265
MspI CCGG 7 cut(s) 10, 42, 75, 105, 137, 170, 217
MspR9I CCNGG 7 cut(s) 10, 42, 75, 105, 114, 137, 170
MvaI CCWGG 1 cut(s) 114
MwoI GCNNNNNNNGC 8 cut(s) 10, 42, 75, 84, 105, 137, 170, 217
NciI CCSGG 6 cut(s) 10, 42, 75, 105, 137, 170
NlaIII CATG 7 cut(s) 36, 69, 99, 131, 164, 211, 244
NlaIV GGNNCC 1 cut(s) 79
NspI RCATGY 1 cut(s) 211
PaeR7I CTCGAG 1 cut(s) 226
PfoI TCCNGGA 1 cut(s) 112
Psp6I CCWGG 1 cut(s) 112
PspGI CCWGG 1 cut(s) 112
PspN4I GGNNCC 1 cut(s) 79
PspXI VCTCGAGB 1 cut(s) 226
SaqAI TTAA 1 cut(s) 265
ScrFI CCNGG 7 cut(s) 10, 42, 75, 105, 114, 137, 170
SetI ASST 8 cut(s) 26, 58, 89, 121, 153, 200, 233, 265
Sfr274I CTCGAG 1 cut(s) 226
SlaI CTCGAG 1 cut(s) 226
SmlI CTYRAG 2 cut(s) 19, 226
SmoI CTYRAG 2 cut(s) 19, 226
SsiI CCGC 5 cut(s) 28, 61, 123, 156, 203
StyD4I CCNGG 7 cut(s) 8, 40, 73, 103, 112, 135, 168
TaiI ACGT 1 cut(s) 265
TaqI TCGA 2 cut(s) 227, 250
Tru1I TTAA 1 cut(s) 265
Tru9I TTAA 1 cut(s) 265
XceI RCATGY 1 cut(s) 211
XhoI CTCGAG 1 cut(s) 226
XmiI GTMKAC 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.