Rmu_sc0004066.1_g000001

GPI-anchored protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004066.1
OG0025562
Physical Location & Seq
Forward (+)
993 .. 1802
810 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004066.1_g000001.1.cds

Sequence Viewer

Length: 279 bp
atggtcactggagcagcatatggtcaacaagggtgtctgcttagaagcctgcctgcagatgtgatgtttgacaattcaactggcttcagctttacatgtgatttaagtgataatattgcagctccatggccttcatcgtcctcaatttcatcagtgtccctctgtgggcctgagatgtcattgcccgcactaccaacatcggagacttttaaaaatcctggtgtgtcattgcatcctgagtttatggctattttgaatttcaagttcctcgagtcgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

9.77

Weight (kDa)

4.28

Isoelectric Point (pI)

58.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025562)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0003452.1_g000011 Rmu_sc0004066.1_g000001 Rmu_sc0041072.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 186
AcsI RAATTY 1 cut(s) 256
AcuI CTGAAG 1 cut(s) 70
AfiI CCNNNNNNNGG 1 cut(s) 165
AflIII ACRYGT 1 cut(s) 95
AgsI TTSAA 3 cut(s) 78, 256, 262
AjnI CCWGG 1 cut(s) 217
AluBI AGCT 2 cut(s) 90, 122
AluI AGCT 2 cut(s) 90, 122
Alw26I GTCTC 1 cut(s) 197
Ama87I CYCGRG 1 cut(s) 269
AoxI GGCC 2 cut(s) 128, 167
ApeKI GCWGC 2 cut(s) 14, 119
ApoI RAATTY 1 cut(s) 256
AspS9I GGNCC 1 cut(s) 167
AvaI CYCGRG 1 cut(s) 269
BbvI GCAGC 2 cut(s) 26, 131
BciT130I CCWGG 1 cut(s) 219
BcoDI GTCTC 1 cut(s) 197
BfmI CTRYAG 1 cut(s) 54
BisI GCNGC 2 cut(s) 15, 120
BlsI GCNGC 2 cut(s) 16, 121
Bme1390I CCNGG 1 cut(s) 219
BmeT110I CYCGRG 1 cut(s) 269
BmgT120I GGNCC 1 cut(s) 167
BmrFI CCNGG 1 cut(s) 219
BmsI GCATC 1 cut(s) 241
BpmI CTGGAG 1 cut(s) 30
BsaJI CCNNGG 1 cut(s) 125
Bsc4I CCNNNNNNNGG 1 cut(s) 165
Bse1I ACTGG 2 cut(s) 13, 85
Bse3DI GCAATG 2 cut(s) 179, 227
BseBI CCWGG 1 cut(s) 219
BseDI CCNNGG 1 cut(s) 125
BseGI GGATG 1 cut(s) 232
BseLI CCNNNNNNNGG 1 cut(s) 165
BseMI GCAATG 2 cut(s) 179, 227
BseMII CTCAG 2 cut(s) 162, 228
BseNI ACTGG 2 cut(s) 13, 85
BseXI GCAGC 2 cut(s) 26, 131
BshFI GGCC 2 cut(s) 130, 169
BsiHKCI CYCGRG 1 cut(s) 269
BslFI GGGAC 1 cut(s) 142
BslI CCNNNNNNNGG 1 cut(s) 165
BsmAI GTCTC 1 cut(s) 197
BsmFI GGGAC 1 cut(s) 142
BsnI GGCC 2 cut(s) 130, 169
BsoBI CYCGRG 1 cut(s) 269
Bsp19I CCATGG 1 cut(s) 125
BspACI CCGC 1 cut(s) 186
BspANI GGCC 2 cut(s) 130, 169
BspCNI CTCAG 2 cut(s) 163, 229
BspMAI CTGCAG 1 cut(s) 58
BsrDI GCAATG 2 cut(s) 179, 227
BsrI ACTGG 2 cut(s) 13, 85
BssECI CCNNGG 1 cut(s) 125
BssT1I CCWWGG 1 cut(s) 125
Bst2UI CCWGG 1 cut(s) 219
BstC8I GCNNGC 3 cut(s) 50, 54, 186
BstDEI CTNAG 3 cut(s) 41, 171, 237
BstDSI CCRYGG 1 cut(s) 125
BstF5I GGATG 1 cut(s) 232
BstMAI GTCTC 1 cut(s) 197
BstNI CCWGG 1 cut(s) 219
BstNSI RCATGY 1 cut(s) 99
BstSCI CCNGG 1 cut(s) 217
BstSFI CTRYAG 1 cut(s) 54
BstV1I GCAGC 2 cut(s) 26, 131
BsuRI GGCC 2 cut(s) 130, 169
BtgI CCRYGG 1 cut(s) 125
BtsCI GGATG 1 cut(s) 232
BtsIMutI CAGTG 2 cut(s) 6, 159
Cac8I GCNNGC 3 cut(s) 50, 54, 186
Cfr13I GGNCC 1 cut(s) 167
CviAII CATG 2 cut(s) 96, 126
CviJI RGCY 7 cut(s) 48, 84, 90, 122, 130, 169, 248
CviKI_1 RGCY 7 cut(s) 48, 84, 90, 122, 130, 169, 248
DdeI CTNAG 3 cut(s) 41, 171, 237
DraI TTTAAA 1 cut(s) 211
Eco130I CCWWGG 1 cut(s) 125
Eco57I CTGAAG 1 cut(s) 70
Eco88I CYCGRG 1 cut(s) 269
EcoRII CCWGG 1 cut(s) 217
EcoT14I CCWWGG 1 cut(s) 125
ErhI CCWWGG 1 cut(s) 125
FaeI CATG 2 cut(s) 99, 129
FaiI YATR 5 cut(s) 19, 21, 97, 127, 245
FaqI GGGAC 1 cut(s) 142
FatI CATG 2 cut(s) 95, 125
FauI CCCGC 1 cut(s) 193
FauNDI CATATG 1 cut(s) 19
Fnu4HI GCNGC 2 cut(s) 15, 120
FokI GGATG 1 cut(s) 219
Fsp4HI GCNGC 2 cut(s) 15, 120
GluI GCNGC 2 cut(s) 15, 120
GsuI CTGGAG 1 cut(s) 30
HaeIII GGCC 2 cut(s) 130, 169
Hin1II CATG 2 cut(s) 99, 129
HincII GTYRAC 1 cut(s) 26
HindII GTYRAC 1 cut(s) 26
HinfI GANTC 1 cut(s) 272
Hpy166II GTNNAC 1 cut(s) 26
Hpy188I TCNGA 1 cut(s) 202
Hpy188III TCNNGA 1 cut(s) 236
Hpy8I GTNNAC 1 cut(s) 26
HpyAV CCTTC 1 cut(s) 141
HpyCH4V TGCA 3 cut(s) 56, 119, 232
HpyF3I CTNAG 3 cut(s) 41, 171, 237
Hsp92II CATG 2 cut(s) 99, 129
LmnI GCTCC 2 cut(s) 11, 127
LpnPI CCDG 7 cut(s) 62, 66, 66, 183, 204, 231, 249
Lsp1109I GCAGC 2 cut(s) 26, 131
LweI GCATC 1 cut(s) 241
MaeIII GTNAC 1 cut(s) 4
MluCI AATT 3 cut(s) 73, 144, 256
MnlI CCTC 3 cut(s) 151, 170, 278
MseI TTAA 2 cut(s) 104, 210
MspR9I CCNGG 1 cut(s) 219
MvaI CCWGG 1 cut(s) 219
NcoI CCATGG 1 cut(s) 125
NdeI CATATG 1 cut(s) 19
NlaIII CATG 2 cut(s) 99, 129
NmuCI GTSAC 1 cut(s) 4
NspI RCATGY 1 cut(s) 99
PaeR7I CTCGAG 1 cut(s) 269
PciI ACATGT 1 cut(s) 95
PkrI GCNGC 2 cut(s) 16, 121
PscI ACATGT 1 cut(s) 95
Psp6I CCWGG 1 cut(s) 217
PspGI CCWGG 1 cut(s) 217
PspPI GGNCC 1 cut(s) 167
PspXI VCTCGAGB 1 cut(s) 269
PstI CTGCAG 1 cut(s) 58
SaqAI TTAA 2 cut(s) 104, 210
SatI GCNGC 2 cut(s) 15, 120
Sau96I GGNCC 1 cut(s) 167
ScrFI CCNGG 1 cut(s) 219
SetI ASST 2 cut(s) 92, 124
SfaNI GCATC 1 cut(s) 241
SfcI CTRYAG 1 cut(s) 54
Sfr274I CTCGAG 1 cut(s) 269
SlaI CTCGAG 1 cut(s) 269
SmlI CTYRAG 1 cut(s) 269
SmoI CTYRAG 1 cut(s) 269
Sse9I AATT 3 cut(s) 73, 144, 256
SsiI CCGC 1 cut(s) 186
SspI AATATT 1 cut(s) 115
StyD4I CCNGG 1 cut(s) 217
StyI CCWWGG 1 cut(s) 125
TaqI TCGA 1 cut(s) 270
TasI AATT 3 cut(s) 73, 144, 256
Tru1I TTAA 2 cut(s) 104, 210
Tru9I TTAA 2 cut(s) 104, 210
TscAI CASTG 2 cut(s) 13, 159
TseFI GTSAC 1 cut(s) 4
TseI GCWGC 2 cut(s) 14, 119
Tsp45I GTSAC 1 cut(s) 4
TspDTI ATGAA 2 cut(s) 123, 138
TspRI CASTG 2 cut(s) 13, 159
XapI RAATTY 1 cut(s) 256
XceI RCATGY 1 cut(s) 99
XhoI CTCGAG 1 cut(s) 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.