Rmu_sc0041072.1_g000001

GPI-anchored protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0041072.1
OG0025562
Physical Location & Seq
Forward (+)
5331 .. 6740
1410 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0041072.1_g000001.1.cds

Sequence Viewer

Length: 294 bp
atggtcactggagcagcatatggtcaacaagggtgtctgcttagaagcctgcctgcagatgtgatgtttgacaattcaactggcttcagctttacatgtgatttaagtgataatattgcagctccatggccttcatcgtcctcaatttcatcagtgtccctctgtgggcctgagatgtcattgcccgcactaccaacatcggagacttttaaaaatcctggctgtcgtggtggagggcagcaatttcttgtaaccattatttcatttttggttttcgggactttattgtactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

10.18

Weight (kDa)

4.23

Isoelectric Point (pI)

53.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025562)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0003452.1_g000011 Rmu_sc0004066.1_g000001 Rmu_sc0041072.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 186
AcuI CTGAAG 1 cut(s) 70
AfaI GTAC 1 cut(s) 290
AfiI CCNNNNNNNGG 1 cut(s) 165
AflIII ACRYGT 1 cut(s) 95
AgsI TTSAA 1 cut(s) 78
AjnI CCWGG 1 cut(s) 217
AluBI AGCT 2 cut(s) 90, 122
AluI AGCT 2 cut(s) 90, 122
Alw26I GTCTC 1 cut(s) 197
AoxI GGCC 2 cut(s) 128, 167
ApeKI GCWGC 3 cut(s) 14, 119, 238
AspS9I GGNCC 1 cut(s) 167
BbvI GCAGC 3 cut(s) 26, 131, 250
BciT130I CCWGG 1 cut(s) 219
BcoDI GTCTC 1 cut(s) 197
BfmI CTRYAG 1 cut(s) 54
BisI GCNGC 3 cut(s) 15, 120, 239
BlsI GCNGC 3 cut(s) 16, 121, 240
Bme1390I CCNGG 1 cut(s) 219
BmgT120I GGNCC 1 cut(s) 167
BmrFI CCNGG 1 cut(s) 219
BpmI CTGGAG 1 cut(s) 30
BsaJI CCNNGG 1 cut(s) 125
Bsc4I CCNNNNNNNGG 1 cut(s) 165
Bse1I ACTGG 2 cut(s) 13, 85
Bse3DI GCAATG 1 cut(s) 179
BseBI CCWGG 1 cut(s) 219
BseDI CCNNGG 1 cut(s) 125
BseLI CCNNNNNNNGG 1 cut(s) 165
BseMI GCAATG 1 cut(s) 179
BseMII CTCAG 1 cut(s) 162
BseNI ACTGG 2 cut(s) 13, 85
BseXI GCAGC 3 cut(s) 26, 131, 250
BshFI GGCC 2 cut(s) 130, 169
BslFI GGGAC 1 cut(s) 142
BslI CCNNNNNNNGG 1 cut(s) 165
BsmAI GTCTC 1 cut(s) 197
BsmFI GGGAC 1 cut(s) 142
BsnI GGCC 2 cut(s) 130, 169
Bsp19I CCATGG 1 cut(s) 125
BspACI CCGC 1 cut(s) 186
BspANI GGCC 2 cut(s) 130, 169
BspCNI CTCAG 1 cut(s) 163
BspMAI CTGCAG 1 cut(s) 58
BsrDI GCAATG 1 cut(s) 179
BsrI ACTGG 2 cut(s) 13, 85
BssECI CCNNGG 1 cut(s) 125
BssT1I CCWWGG 1 cut(s) 125
Bst2UI CCWGG 1 cut(s) 219
BstC8I GCNNGC 3 cut(s) 50, 54, 186
BstDEI CTNAG 2 cut(s) 41, 171
BstDSI CCRYGG 1 cut(s) 125
BstMAI GTCTC 1 cut(s) 197
BstNI CCWGG 1 cut(s) 219
BstNSI RCATGY 1 cut(s) 99
BstSCI CCNGG 1 cut(s) 217
BstSFI CTRYAG 1 cut(s) 54
BstV1I GCAGC 3 cut(s) 26, 131, 250
BsuRI GGCC 2 cut(s) 130, 169
BtgI CCRYGG 1 cut(s) 125
BtsIMutI CAGTG 2 cut(s) 6, 159
Cac8I GCNNGC 3 cut(s) 50, 54, 186
Cfr13I GGNCC 1 cut(s) 167
Csp6I GTAC 1 cut(s) 289
CviAII CATG 2 cut(s) 96, 126
CviJI RGCY 7 cut(s) 48, 84, 90, 122, 130, 169, 222
CviKI_1 RGCY 7 cut(s) 48, 84, 90, 122, 130, 169, 222
CviQI GTAC 1 cut(s) 289
DdeI CTNAG 2 cut(s) 41, 171
DraI TTTAAA 1 cut(s) 211
Eco130I CCWWGG 1 cut(s) 125
Eco57I CTGAAG 1 cut(s) 70
EcoRII CCWGG 1 cut(s) 217
EcoT14I CCWWGG 1 cut(s) 125
ErhI CCWWGG 1 cut(s) 125
FaeI CATG 2 cut(s) 99, 129
FaiI YATR 4 cut(s) 19, 21, 97, 127
FaqI GGGAC 1 cut(s) 142
FatI CATG 2 cut(s) 95, 125
FauI CCCGC 1 cut(s) 193
FauNDI CATATG 1 cut(s) 19
Fnu4HI GCNGC 3 cut(s) 15, 120, 239
Fsp4HI GCNGC 3 cut(s) 15, 120, 239
GluI GCNGC 3 cut(s) 15, 120, 239
GsuI CTGGAG 1 cut(s) 30
HaeIII GGCC 2 cut(s) 130, 169
Hin1II CATG 2 cut(s) 99, 129
HincII GTYRAC 1 cut(s) 26
HindII GTYRAC 1 cut(s) 26
Hpy166II GTNNAC 1 cut(s) 26
Hpy188I TCNGA 1 cut(s) 202
Hpy188III TCNNGA 1 cut(s) 277
Hpy8I GTNNAC 1 cut(s) 26
HpyAV CCTTC 1 cut(s) 141
HpyCH4V TGCA 2 cut(s) 56, 119
HpyF3I CTNAG 2 cut(s) 41, 171
Hsp92II CATG 2 cut(s) 99, 129
LmnI GCTCC 2 cut(s) 11, 127
LpnPI CCDG 6 cut(s) 62, 66, 66, 183, 204, 231
Lsp1109I GCAGC 3 cut(s) 26, 131, 250
MaeIII GTNAC 2 cut(s) 4, 250
MluCI AATT 3 cut(s) 73, 144, 242
MnlI CCTC 3 cut(s) 151, 170, 227
MseI TTAA 2 cut(s) 104, 210
MspR9I CCNGG 1 cut(s) 219
MvaI CCWGG 1 cut(s) 219
NcoI CCATGG 1 cut(s) 125
NdeI CATATG 1 cut(s) 19
NlaIII CATG 2 cut(s) 99, 129
NmuCI GTSAC 1 cut(s) 4
NspI RCATGY 1 cut(s) 99
PciI ACATGT 1 cut(s) 95
PkrI GCNGC 3 cut(s) 16, 121, 240
PscI ACATGT 1 cut(s) 95
Psp6I CCWGG 1 cut(s) 217
PspGI CCWGG 1 cut(s) 217
PspPI GGNCC 1 cut(s) 167
PstI CTGCAG 1 cut(s) 58
RsaI GTAC 1 cut(s) 290
RsaNI GTAC 1 cut(s) 289
SaqAI TTAA 2 cut(s) 104, 210
SatI GCNGC 3 cut(s) 15, 120, 239
Sau96I GGNCC 1 cut(s) 167
ScrFI CCNGG 1 cut(s) 219
SetI ASST 2 cut(s) 92, 124
SfcI CTRYAG 1 cut(s) 54
Sse9I AATT 3 cut(s) 73, 144, 242
SsiI CCGC 1 cut(s) 186
SspI AATATT 1 cut(s) 115
StyD4I CCNGG 1 cut(s) 217
StyI CCWWGG 1 cut(s) 125
TasI AATT 3 cut(s) 73, 144, 242
TatI WGTACW 1 cut(s) 288
Tru1I TTAA 2 cut(s) 104, 210
Tru9I TTAA 2 cut(s) 104, 210
TscAI CASTG 2 cut(s) 13, 159
TseFI GTSAC 1 cut(s) 4
TseI GCWGC 3 cut(s) 14, 119, 238
Tsp45I GTSAC 1 cut(s) 4
TspDTI ATGAA 3 cut(s) 123, 138, 252
TspRI CASTG 2 cut(s) 13, 159
XceI RCATGY 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.