Rmu_sc0004250.1_g000027
MYB Family

SANT SWI3, ADA2, N-CoR and TFIIIB'' DNA-binding domains

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004250.1
Physical Location & Seq
Forward (+)
127624 .. 127932
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004250.1_g000027.1.cds

Sequence Viewer

Length: 309 bp
atgaagagtctccctcctccatccctgaattcatctgttgtgatacagatgtggacaatattgcatggattaagagtggccttgagcattgtgagacgacgagtagcagagaatgtagcaagccagagattctcacaagggacggctactacttcgcaaatggggtattatgaactgaatatgatgaatgggcataagcgccttgtggagggacagaacaggctaattggtatgatgacagaaatgctttcaacccagaagcgtggacaaacttttgcaatgccaactgaagttaaaggactgagctag

Protein Analysis

102

Amino Acids

11.41

Weight (kDa)

10.93

Isoelectric Point (pI)

48.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022612)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0369051
rosa_multiflora Rmu_sc0004250.1_g000027
rosa_roxburghii Rroxscaffold_4G00288050
rosa_samantha Rh1AG354300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 28
AcuI CTGAAG 1 cut(s) 309
AfiI CCNNNNNNNGG 1 cut(s) 208
AgsI TTSAA 1 cut(s) 252
AluBI AGCT 1 cut(s) 306
AluI AGCT 1 cut(s) 306
Alw26I GTCTC 2 cut(s) 14, 88
AoxI GGCC 1 cut(s) 78
ApoI RAATTY 1 cut(s) 28
AspLEI GCGC 1 cut(s) 201
BaeI ACNNNNGTAYC 2 cut(s) 35, 68
BccI CCATC 1 cut(s) 28
BceAI ACGGC 1 cut(s) 159
BcoDI GTCTC 2 cut(s) 14, 88
BfaI CTAG 1 cut(s) 307
BfoI RGCGCY 1 cut(s) 202
BplI GAGNNNNNCTC 1 cut(s) 30
BpuEI CTTGAG 1 cut(s) 103
Bsc4I CCNNNNNNNGG 1 cut(s) 208
Bse3DI GCAATG 1 cut(s) 285
BseGI GGATG 1 cut(s) 20
BseLI CCNNNNNNNGG 1 cut(s) 208
BseMI GCAATG 1 cut(s) 285
BseMII CTCAG 1 cut(s) 293
BseRI GAGGAG 1 cut(s) 6
BshFI GGCC 1 cut(s) 80
BslFI GGGAC 2 cut(s) 154, 225
BslI CCNNNNNNNGG 1 cut(s) 208
BsmAI GTCTC 2 cut(s) 14, 88
BsmBI CGTCTC 1 cut(s) 88
BsmFI GGGAC 2 cut(s) 154, 225
BsnI GGCC 1 cut(s) 80
BspANI GGCC 1 cut(s) 80
BspCNI CTCAG 1 cut(s) 294
BsrDI GCAATG 1 cut(s) 285
BstC8I GCNNGC 1 cut(s) 121
BstDEI CTNAG 1 cut(s) 302
BstENI CCTNNNNNAGG 1 cut(s) 206
BstF5I GGATG 1 cut(s) 20
BstH2I RGCGCY 1 cut(s) 202
BstHHI GCGC 1 cut(s) 201
BstMAI GTCTC 2 cut(s) 14, 88
BstXI CCANNNNNNTGG 1 cut(s) 263
BsuRI GGCC 1 cut(s) 80
BtsCI GGATG 1 cut(s) 20
Cac8I GCNNGC 1 cut(s) 121
CfoI GCGC 1 cut(s) 201
CviAII CATG 1 cut(s) 65
CviJI RGCY 5 cut(s) 80, 123, 146, 223, 306
CviKI_1 RGCY 5 cut(s) 80, 123, 146, 223, 306
DdeI CTNAG 1 cut(s) 302
Eco57I CTGAAG 1 cut(s) 309
EcoNI CCTNNNNNAGG 1 cut(s) 206
EcoRI GAATTC 1 cut(s) 28
Esp3I CGTCTC 1 cut(s) 88
FaeI CATG 1 cut(s) 68
FaiI YATR 5 cut(s) 66, 171, 182, 195, 233
FaqI GGGAC 2 cut(s) 154, 225
FatI CATG 1 cut(s) 64
FokI GGATG 1 cut(s) 7
FspBI CTAG 1 cut(s) 307
GlaI GCGC 1 cut(s) 200
HaeII RGCGCY 1 cut(s) 202
HaeIII GGCC 1 cut(s) 80
HhaI GCGC 1 cut(s) 201
Hin1II CATG 1 cut(s) 68
Hin6I GCGC 1 cut(s) 199
HinP1I GCGC 1 cut(s) 199
HinfI GANTC 2 cut(s) 7, 129
Hpy166II GTNNAC 2 cut(s) 54, 266
Hpy8I GTNNAC 2 cut(s) 54, 266
Hpy99I CGWCG 1 cut(s) 102
HpyCH4V TGCA 2 cut(s) 64, 278
HpyF3I CTNAG 1 cut(s) 302
Hsp92II CATG 1 cut(s) 68
HspAI GCGC 1 cut(s) 199
LpnPI CCDG 4 cut(s) 38, 137, 205, 269
MaeI CTAG 1 cut(s) 307
MboII GAAGA 1 cut(s) 16
MluCI AATT 2 cut(s) 28, 225
MlyI GAGTC 1 cut(s) 16
MnlI CCTC 3 cut(s) 24, 27, 202
MseI TTAA 2 cut(s) 71, 294
NlaIII CATG 1 cut(s) 68
PfeI GAWTC 1 cut(s) 129
PleI GAGTC 1 cut(s) 15
PpsI GAGTC 1 cut(s) 15
SaqAI TTAA 2 cut(s) 71, 294
SchI GAGTC 1 cut(s) 16
SetI ASST 1 cut(s) 308
SmlI CTYRAG 1 cut(s) 82
SmoI CTYRAG 1 cut(s) 82
Sse9I AATT 2 cut(s) 28, 225
SspI AATATT 1 cut(s) 60
SspMI CTAG 1 cut(s) 307
TasI AATT 2 cut(s) 28, 225
TfiI GAWTC 1 cut(s) 129
Tru1I TTAA 2 cut(s) 71, 294
Tru9I TTAA 2 cut(s) 71, 294
TspDTI ATGAA 4 cut(s) 17, 21, 186, 200
XagI CCTNNNNNAGG 1 cut(s) 206
XapI RAATTY 1 cut(s) 28
XspI CTAG 1 cut(s) 307
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.