Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000004

Orthogroup ID

OG0022612

Physical Location & Seq

Genomic Coordinates Forward (+)

8965655 .. 8968525

Gene Structure 2871 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_4G00288050.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 150 bp

ATGGGGTATTATGAACTGAATATGATGAATGGGCATAAGCGTCTTGTGGAGGGACAGAACAGGCTAATTGGTATGATGACAGAAATGCTTTCAACCCAGATGCGTGGACAAACTTTTACAATGCCAACTGAAGTTAAGGGACTGAGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000981 GO:0000988 GO:0000989 GO:0001067 GO:0001076 GO:0001101 GO:0001134 GO:0001135 GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0006357 GO:0006950 GO:0006952 GO:0006970 GO:0007275 GO:0008150 GO:0009414 GO:0009415 GO:0009555 GO:0009605 GO:0009607 GO:0009617 GO:0009620 GO:0009628 GO:0009651 GO:0009719 GO:0009723 GO:0009725 GO:0009733 GO:0009737 GO:0009739 GO:0009751 GO:0009753 GO:0009889 GO:0009966 GO:0009967 GO:0009987 GO:0010033 GO:0010035 GO:0010038 GO:0010200 GO:0010243 GO:0010468 GO:0010556 GO:0010646 GO:0010647 GO:0010928 GO:0010929 GO:0014070 GO:0019219 GO:0019222 GO:0023051 GO:0023056 GO:0030154 GO:0031323 GO:0031326 GO:0032501 GO:0032502 GO:0033993 GO:0042221 GO:0042493 GO:0042742 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044212 GO:0044424 GO:0044464 GO:0046677 GO:0046686 GO:0048229 GO:0048518 GO:0048522 GO:0048583 GO:0048584 GO:0048856 GO:0048869 GO:0050789 GO:0050794 GO:0050832 GO:0050896 GO:0051171 GO:0051252 GO:0051704 GO:0051707 GO:0060255 GO:0065007 GO:0080090 GO:0097159 GO:0097305 GO:0098542 GO:0140110 GO:1901363 GO:1901698 GO:1901700 GO:1903506 GO:2000022 GO:2000031 GO:2000112 GO:2001023 GO:2001038 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

49

Amino Acids

5.64

Weight (kDa)

8.21

Isoelectric Point (pI)

27.91

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022612)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0369051
rosa_multiflora	Rmu_sc0004250.1_g000027
rosa_roxburghii	Rroxscaffold_4G00288050
rosa_samantha	Rh1AG354300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	150
AgsI	TTSAA	1 cut(s)	93
AluBI	AGCT	1 cut(s)	147
AluI	AGCT	1 cut(s)	147
BfaI	CTAG	1 cut(s)	148
BmsI	GCATC	1 cut(s)	90
BseMII	CTCAG	1 cut(s)	134
BslFI	GGGAC	1 cut(s)	66
BsmFI	GGGAC	1 cut(s)	66
BspCNI	CTCAG	1 cut(s)	135
BstDEI	CTNAG	1 cut(s)	143
BstXI	CCANNNNNNTGG	1 cut(s)	104
CseI	GACGC	1 cut(s)	29
CviJI	RGCY	2 cut(s)	64, 147
CviKI_1	RGCY	2 cut(s)	64, 147
DdeI	CTNAG	1 cut(s)	143
Eco57I	CTGAAG	1 cut(s)	150
FaiI	YATR	4 cut(s)	12, 23, 36, 74
FaqI	GGGAC	1 cut(s)	66
FspBI	CTAG	1 cut(s)	148
HgaI	GACGC	1 cut(s)	29
Hpy166II	GTNNAC	1 cut(s)	107
Hpy8I	GTNNAC	1 cut(s)	107
HpyF3I	CTNAG	1 cut(s)	143
LpnPI	CCDG	2 cut(s)	46, 110
LweI	GCATC	1 cut(s)	90
MaeI	CTAG	1 cut(s)	148
MluCI	AATT	1 cut(s)	66
MnlI	CCTC	1 cut(s)	43
MseI	TTAA	1 cut(s)	135
SaqAI	TTAA	1 cut(s)	135
SetI	ASST	1 cut(s)	149
SfaNI	GCATC	1 cut(s)	90
SgeI	CNNG	4 cut(s)	56, 73, 109, 116
Sse9I	AATT	1 cut(s)	66
SspMI	CTAG	1 cut(s)	148
TasI	AATT	1 cut(s)	66
Tru1I	TTAA	1 cut(s)	135
Tru9I	TTAA	1 cut(s)	135
TspDTI	ATGAA	2 cut(s)	27, 41
XspI	CTAG	1 cut(s)	148

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.