Rmu_sc0004316.1_g000010

Flavonoid 3-hydroxylase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004316.1
Physical Location & Seq
Forward (+)
43991 .. 48744
4754 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004316.1_g000010.1.cds

Sequence Viewer

Length: 855 bp
atgaggccggatgaacgacctttgtttcataagaggatacaatgggacaagtgcaacctagaggccaccatgaccattctgaggatggggtccgagccactccaagttgacaaggaggcctatctttttatggaaatcgagatgacagatccttttgagaggaacgacctctgtttcatgtttcatgagaggatacgatgtgacaagtgtaaccggaaggccaccatcaccatcatgaggatgaggtctgagctactccaagctgataaaaggaggcttgtcctcttatggaaaccggaaggctacgagagtttattagtcgagatggaatttgaaatagcaaagcaaattttaaggacgcatgatcatgtgtttgcctccagaccccaagctgcagctggcaagtacaccacttacaaccacctcaacatcagttgggcacctcacggcccatattggcgccaaggccgcaaaatctacctctccgagctattcaactcgaagagactagactcctttgagtacattcgtgtggaggaaactcgcgctttcatccaggtacatgcgatcatgaaagagacaatgaggaaacaccctgttgctgtaatgctggcaccacatctggctcttgaagattgcaatgtggaaggaaggaggatgtgccctggttatagccttggattgaaactgattcggtctagcatagctaacatgcttcatggattcaactggaaattgcctgagaatatgaaaccagaagatctgagcatggatgaagtttatggattggcaacaccaaggaagtttccacttgttgcagtcgtggagcctaggctcccaaaccatctttattaa

Protein Analysis

284

Amino Acids

33.57

Weight (kDa)

8.81

Isoelectric Point (pI)

42.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024883)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0094951
rosa_multiflora Rmu_sc0004316.1_g000010
rosa_samantha Rh2CG434600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 3 cut(s) 439, 459, 613
AccII CGCG 1 cut(s) 546
AciI CCGC 1 cut(s) 469
AclWI GGATC 1 cut(s) 143
AcsI RAATTY 2 cut(s) 329, 348
AcyI GRCGYC 1 cut(s) 460
AfaI GTAC 3 cut(s) 407, 524, 561
AfiI CCNNNNNNNGG 2 cut(s) 81, 237
AgsI TTSAA 5 cut(s) 335, 496, 632, 685, 727
AjnI CCWGG 2 cut(s) 555, 664
AluBI AGCT 6 cut(s) 253, 263, 392, 398, 490, 707
AluI AGCT 6 cut(s) 253, 263, 392, 398, 490, 707
Alw26I GTCTC 2 cut(s) 499, 572
AlwI GGATC 1 cut(s) 143
AoxI GGCC 6 cut(s) 5, 63, 117, 219, 448, 466
ApeKI GCWGC 2 cut(s) 392, 395
ApoI RAATTY 2 cut(s) 329, 348
AspA2I CCTAGG 1 cut(s) 830
AspLEI GCGC 2 cut(s) 462, 548
AspS9I GGNCC 2 cut(s) 90, 449
AsuHPI GGTGA 1 cut(s) 220
AvaII GGWCC 1 cut(s) 90
AvrII CCTAGG 1 cut(s) 830
BaeGI GKGCMC 2 cut(s) 442, 665
BanI GGYRCC 3 cut(s) 439, 459, 613
BbvI GCAGC 2 cut(s) 379, 407
BccI CCATC 5 cut(s) 79, 233, 239, 319, 852
BceAI ACGGC 1 cut(s) 463
BciT130I CCWGG 2 cut(s) 557, 666
BciVI GTATCC 2 cut(s) 30, 186
BclI TGATCA 1 cut(s) 364
BcoDI GTCTC 2 cut(s) 499, 572
BfaI CTAG 4 cut(s) 59, 509, 699, 831
BfmI CTRYAG 1 cut(s) 393
BfoI RGCGCY 1 cut(s) 463
BfuI GTATCC 2 cut(s) 30, 186
BglII AGATCT 1 cut(s) 760
BisI GCNGC 3 cut(s) 393, 396, 469
BlnI CCTAGG 1 cut(s) 830
BlsI GCNGC 3 cut(s) 394, 397, 470
Bme1390I CCNGG 2 cut(s) 557, 666
Bme18I GGWCC 1 cut(s) 90
BmgT120I GGNCC 2 cut(s) 90, 449
BmiI GGNNCC 6 cut(s) 91, 441, 461, 615, 828, 836
BmrFI CCNGG 2 cut(s) 557, 666
BpmI CTGGAG 1 cut(s) 364
BsaHI GRCGYC 1 cut(s) 460
BsaJI CCNNGG 5 cut(s) 463, 664, 676, 797, 830
BsaWI WCCGGW 2 cut(s) 213, 295
Bsc4I CCNNNNNNNGG 2 cut(s) 81, 237
Bse1I ACTGG 1 cut(s) 734
Bse3DI GCAATG 1 cut(s) 646
BseBI CCWGG 2 cut(s) 557, 666
BseDI CCNNGG 5 cut(s) 463, 664, 676, 797, 830
BseGI GGATG 6 cut(s) 16, 90, 246, 552, 663, 778
BseLI CCNNNNNNNGG 2 cut(s) 81, 237
BseMI GCAATG 1 cut(s) 646
BseMII CTCAG 4 cut(s) 71, 240, 732, 755
BseNI ACTGG 1 cut(s) 734
BseSI GKGCMC 2 cut(s) 442, 665
BseXI GCAGC 2 cut(s) 379, 407
Bsh1236I CGCG 1 cut(s) 546
BshFI GGCC 6 cut(s) 7, 65, 119, 221, 450, 468
BshNI GGYRCC 3 cut(s) 439, 459, 613
BsiSI CCGG 3 cut(s) 8, 214, 296
BslFI GGGAC 1 cut(s) 59
BslI CCNNNNNNNGG 2 cut(s) 81, 237
BsmAI GTCTC 2 cut(s) 499, 572
BsmFI GGGAC 1 cut(s) 59
BsnI GGCC 6 cut(s) 7, 65, 119, 221, 450, 468
Bsp1286I GDGCHC 2 cut(s) 442, 665
Bsp143I GATC 4 cut(s) 148, 364, 567, 760
BspACI CCGC 1 cut(s) 469
BspANI GGCC 6 cut(s) 7, 65, 119, 221, 450, 468
BspCNI CTCAG 4 cut(s) 72, 241, 733, 756
BspFNI CGCG 1 cut(s) 546
BspHI TCATGA 3 cut(s) 184, 234, 570
BspLI GGNNCC 6 cut(s) 91, 441, 461, 615, 828, 836
BspMAI CTGCAG 1 cut(s) 397
BspPI GGATC 1 cut(s) 143
BspT107I GGYRCC 3 cut(s) 439, 459, 613
BsrDI GCAATG 1 cut(s) 646
BsrI ACTGG 1 cut(s) 734
BssECI CCNNGG 5 cut(s) 463, 664, 676, 797, 830
BssMI GATC 4 cut(s) 148, 364, 567, 760
BssNI GRCGYC 1 cut(s) 460
BssT1I CCWWGG 4 cut(s) 463, 676, 797, 830
Bst2UI CCWGG 2 cut(s) 557, 666
Bst6I CTCTTC 1 cut(s) 497
BstACI GRCGYC 1 cut(s) 460
BstC8I GCNNGC 2 cut(s) 400, 612
BstDEI CTNAG 4 cut(s) 80, 249, 741, 764
BstF5I GGATG 6 cut(s) 16, 90, 246, 552, 663, 778
BstFNI CGCG 1 cut(s) 546
BstH2I RGCGCY 1 cut(s) 463
BstHHI GCGC 2 cut(s) 462, 548
BstKTI GATC 4 cut(s) 151, 367, 570, 763
BstMAI GTCTC 2 cut(s) 499, 572
BstMBI GATC 4 cut(s) 148, 364, 567, 760
BstMWI GCNNNNNNNGC 1 cut(s) 468
BstNI CCWGG 2 cut(s) 557, 666
BstNSI RCATGY 2 cut(s) 566, 715
BstSCI CCNGG 2 cut(s) 555, 664
BstSFI CTRYAG 1 cut(s) 393
BstSLI GKGCMC 2 cut(s) 442, 665
BstUI CGCG 1 cut(s) 546
BstV1I GCAGC 2 cut(s) 379, 407
BstX2I RGATCY 2 cut(s) 148, 760
BstYI RGATCY 2 cut(s) 148, 760
BsuI GTATCC 2 cut(s) 30, 186
BsuRI GGCC 6 cut(s) 7, 65, 119, 221, 450, 468
BtsCI GGATG 6 cut(s) 16, 90, 246, 552, 663, 778
Cac8I GCNNGC 2 cut(s) 400, 612
CciI TCATGA 3 cut(s) 184, 234, 570
CfoI GCGC 2 cut(s) 462, 548
Cfr13I GGNCC 2 cut(s) 90, 449
CseI GACGC 1 cut(s) 367
Csp6I GTAC 3 cut(s) 406, 523, 560
CviQI GTAC 3 cut(s) 406, 523, 560
DdeI CTNAG 4 cut(s) 80, 249, 741, 764
DinI GGCGCC 1 cut(s) 461
DpnI GATC 4 cut(s) 150, 366, 569, 762
DpnII GATC 4 cut(s) 148, 364, 567, 760
Eam1104I CTCTTC 1 cut(s) 497
EarI CTCTTC 1 cut(s) 497
Eco130I CCWWGG 4 cut(s) 463, 676, 797, 830
Eco147I AGGCCT 1 cut(s) 119
Eco47I GGWCC 1 cut(s) 90
EcoRII CCWGG 2 cut(s) 555, 664
EcoT14I CCWWGG 4 cut(s) 463, 676, 797, 830
EgeI GGCGCC 1 cut(s) 461
EheI GGCGCC 1 cut(s) 461
ErhI CCWWGG 4 cut(s) 463, 676, 797, 830
FaqI GGGAC 1 cut(s) 59
FbaI TGATCA 1 cut(s) 364
Fnu4HI GCNGC 3 cut(s) 393, 396, 469
FokI GGATG 6 cut(s) 23, 97, 253, 539, 670, 785
Fsp4HI GCNGC 3 cut(s) 393, 396, 469
FspBI CTAG 4 cut(s) 59, 509, 699, 831
GlaI GCGC 2 cut(s) 461, 547
GluI GCNGC 3 cut(s) 393, 396, 469
GsuI CTGGAG 1 cut(s) 364
HaeII RGCGCY 1 cut(s) 463
HaeIII GGCC 6 cut(s) 7, 65, 119, 221, 450, 468
HapII CCGG 3 cut(s) 8, 214, 296
HgaI GACGC 1 cut(s) 367
HhaI GCGC 2 cut(s) 462, 548
Hin1I GRCGYC 1 cut(s) 460
Hin6I GCGC 2 cut(s) 460, 546
HinP1I GCGC 2 cut(s) 460, 546
HincII GTYRAC 1 cut(s) 109
HindII GTYRAC 1 cut(s) 109
HinfI GANTC 3 cut(s) 512, 691, 723
HpaII CCGG 3 cut(s) 8, 214, 296
HphI GGTGA 1 cut(s) 220
Hpy166II GTNNAC 2 cut(s) 109, 408
Hpy188I TCNGA 5 cut(s) 81, 94, 250, 487, 765
Hpy188III TCNNGA 7 cut(s) 139, 185, 235, 322, 381, 571, 629
Hpy8I GTNNAC 2 cut(s) 109, 408
HpyAV CCTTC 4 cut(s) 211, 293, 641, 645
HpyCH4V TGCA 4 cut(s) 54, 395, 639, 818
HpyF10VI GCNNNNNNNGC 1 cut(s) 468
HpyF3I CTNAG 4 cut(s) 80, 249, 741, 764
Hsp92I GRCGYC 1 cut(s) 460
HspAI GCGC 2 cut(s) 460, 546
KasI GGCGCC 1 cut(s) 459
Ksp22I TGATCA 1 cut(s) 364
Kzo9I GATC 4 cut(s) 148, 364, 567, 760
LmnI GCTCC 2 cut(s) 826, 840
Lsp1109I GCAGC 2 cut(s) 379, 407
MaeI CTAG 4 cut(s) 59, 509, 699, 831
MaeIII GTNAC 2 cut(s) 200, 209
MalI GATC 4 cut(s) 150, 366, 569, 762
MboI GATC 4 cut(s) 148, 364, 567, 760
MboII GAAGA 3 cut(s) 514, 644, 770
MflI RGATCY 2 cut(s) 148, 760
MhlI GDGCHC 2 cut(s) 442, 665
MluCI AATT 3 cut(s) 329, 348, 734
Mly113I GGCGCC 1 cut(s) 460
MlyI GAGTC 1 cut(s) 506
MseI TTAA 2 cut(s) 353, 853
MslI CAYNNNNRTG 4 cut(s) 233, 239, 366, 530
MspA1I CMGCKG 1 cut(s) 398
MspI CCGG 3 cut(s) 8, 214, 296
MspR9I CCNGG 2 cut(s) 557, 666
MvaI CCWGG 2 cut(s) 557, 666
MvnI CGCG 1 cut(s) 546
MwoI GCNNNNNNNGC 1 cut(s) 468
NarI GGCGCC 1 cut(s) 460
NdeII GATC 4 cut(s) 148, 364, 567, 760
NlaIV GGNNCC 6 cut(s) 91, 441, 461, 615, 828, 836
NmuCI GTSAC 1 cut(s) 200
NspI RCATGY 2 cut(s) 566, 715
PagI TCATGA 3 cut(s) 184, 234, 570
PceI AGGCCT 1 cut(s) 119
PfeI GAWTC 2 cut(s) 691, 723
PkrI GCNGC 3 cut(s) 394, 397, 470
PleI GAGTC 1 cut(s) 506
PluTI GGCGCC 1 cut(s) 463
PpsI GAGTC 1 cut(s) 506
Psp6I CCWGG 2 cut(s) 555, 664
PspGI CCWGG 2 cut(s) 555, 664
PspN4I GGNNCC 6 cut(s) 91, 441, 461, 615, 828, 836
PspPI GGNCC 2 cut(s) 90, 449
PstI CTGCAG 1 cut(s) 397
PsuI RGATCY 2 cut(s) 148, 760
PvuII CAGCTG 1 cut(s) 398
RsaI GTAC 3 cut(s) 407, 524, 561
RsaNI GTAC 3 cut(s) 406, 523, 560
RseI CAYNNNNRTG 4 cut(s) 233, 239, 366, 530
SaqAI TTAA 2 cut(s) 353, 853
SatI GCNGC 3 cut(s) 393, 396, 469
Sau3AI GATC 4 cut(s) 148, 364, 567, 760
Sau96I GGNCC 2 cut(s) 90, 449
SchI GAGTC 1 cut(s) 506
ScrFI CCNGG 2 cut(s) 557, 666
SduI GDGCHC 2 cut(s) 442, 665
SfcI CTRYAG 1 cut(s) 393
SfoI GGCGCC 1 cut(s) 461
SinI GGWCC 1 cut(s) 90
SmiMI CAYNNNNRTG 4 cut(s) 233, 239, 366, 530
Sse9I AATT 3 cut(s) 329, 348, 734
SseBI AGGCCT 1 cut(s) 119
SsiI CCGC 1 cut(s) 469
SspDI GGCGCC 1 cut(s) 459
SspMI CTAG 4 cut(s) 59, 509, 699, 831
StuI AGGCCT 1 cut(s) 119
StyD4I CCNGG 2 cut(s) 555, 664
StyI CCWWGG 4 cut(s) 463, 676, 797, 830
TaqI TCGA 3 cut(s) 138, 321, 500
TaqII GACCGA 1 cut(s) 684
TasI AATT 3 cut(s) 329, 348, 734
TatI WGTACW 2 cut(s) 405, 522
TauI GCSGC 1 cut(s) 471
TfiI GAWTC 2 cut(s) 691, 723
Tru1I TTAA 2 cut(s) 353, 853
Tru9I TTAA 2 cut(s) 353, 853
TseFI GTSAC 1 cut(s) 200
TseI GCWGC 2 cut(s) 392, 395
Tsp45I GTSAC 1 cut(s) 200
TspDTI ATGAA 9 cut(s) 17, 27, 166, 173, 541, 587, 707, 764, 789
VpaK11BI GGWCC 1 cut(s) 90
XapI RAATTY 2 cut(s) 329, 348
XceI RCATGY 2 cut(s) 566, 715
XcmI CCANNNNNNNNNTGG 2 cut(s) 82, 395
XmaJI CCTAGG 1 cut(s) 830
XspI CTAG 4 cut(s) 59, 509, 699, 831
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.