Rmu_sc0004484.1_g000013
ERF Family

Belongs to the protein kinase superfamily. Ser Thr protein kinase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004484.1
Physical Location & Seq
Forward (+)
71346 .. 71693
348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004484.1_g000013.1.cds

Sequence Viewer

Length: 348 bp
atggagatcggaaatttgaagaatctacgtgaactaaacgtttctaacaacttgttatcaacagaacttcccagtagcctcggcagttgccagagcttagaaatcctgagcttgcaaggtaacttcttcttgggggccattccttcatctatgaaggacttgatagggattcgatatttagacctttctcaaaacaatttgtcaggagatattccacagtttcttgagaatctgaacttggagtacctgaacttatccttcaaccagttttggggagcagtaccaactggcggtgtttttaagaatgcaagtgcgacttcagttgctggaaatgctagactctgctga

Protein Analysis

115

Amino Acids

12.45

Weight (kDa)

4.65

Isoelectric Point (pI)

29.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023105)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0004484.1_g000013 Rmu_sc0032286.1_g000001
rosa_roxburghii Rroxscaffold_1G00037400
rosa_rugosa Rorug03G0358000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 291
AclI AACGTT 1 cut(s) 39
AcsI RAATTY 1 cut(s) 13
AcuI CTGAAG 1 cut(s) 303
AfaI GTAC 2 cut(s) 245, 282
AfiI CCNNNNNNNGG 2 cut(s) 271, 290
AgsI TTSAA 2 cut(s) 19, 262
AjuI GAANNNNNNNTTGG 2 cut(s) 221, 253
AluBI AGCT 2 cut(s) 96, 111
AluI AGCT 2 cut(s) 96, 111
AlwNI CAGNNNCTG 1 cut(s) 326
AoxI GGCC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 13
AspS9I GGNCC 1 cut(s) 135
BfaI CTAG 1 cut(s) 336
BmgT120I GGNCC 1 cut(s) 135
BmiI GGNNCC 1 cut(s) 136
BmrI ACTGGG 1 cut(s) 66
BmuI ACTGGG 1 cut(s) 66
Bpu10I CCTNAGC 1 cut(s) 107
BpuEI CTTGAG 1 cut(s) 245
BsaAI YACGTR 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 79
Bsc4I CCNNNNNNNGG 2 cut(s) 271, 290
Bse1I ACTGG 3 cut(s) 72, 265, 292
BseDI CCNNGG 1 cut(s) 79
BseLI CCNNNNNNNGG 2 cut(s) 271, 290
BseMII CTCAG 1 cut(s) 98
BseNI ACTGG 3 cut(s) 72, 265, 292
BshFI GGCC 1 cut(s) 137
BslI CCNNNNNNNGG 2 cut(s) 271, 290
BsmI GAATGC 1 cut(s) 310
BsnI GGCC 1 cut(s) 137
Bsp143I GATC 1 cut(s) 6
BspACI CCGC 1 cut(s) 291
BspANI GGCC 1 cut(s) 137
BspCNI CTCAG 1 cut(s) 99
BspLI GGNNCC 1 cut(s) 136
BsrI ACTGG 3 cut(s) 72, 265, 292
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 219
BstBAI YACGTR 1 cut(s) 29
BstC8I GCNNGC 1 cut(s) 113
BstDEI CTNAG 2 cut(s) 97, 107
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstMWI GCNNNNNNNGC 1 cut(s) 332
BsuRI GGCC 1 cut(s) 137
Cac8I GCNNGC 1 cut(s) 113
CaiI CAGNNNCTG 1 cut(s) 326
Cfr13I GGNCC 1 cut(s) 135
Csp6I GTAC 2 cut(s) 244, 281
CviJI RGCY 4 cut(s) 78, 96, 111, 137
CviKI_1 RGCY 4 cut(s) 78, 96, 111, 137
CviQI GTAC 2 cut(s) 244, 281
DdeI CTNAG 2 cut(s) 97, 107
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
Eco57I CTGAAG 1 cut(s) 303
FaiI YATR 1 cut(s) 152
FalI AAGNNNNNCTT 2 cut(s) 301, 333
FspBI CTAG 1 cut(s) 336
HaeIII GGCC 1 cut(s) 137
HinfI GANTC 4 cut(s) 22, 169, 229, 339
Hpy166II GTNNAC 1 cut(s) 32
Hpy188I TCNGA 2 cut(s) 11, 234
Hpy188III TCNNGA 3 cut(s) 106, 204, 224
Hpy8I GTNNAC 1 cut(s) 32
HpyAV CCTTC 3 cut(s) 148, 153, 268
HpyCH4III ACNGT 1 cut(s) 219
HpyCH4IV ACGT 2 cut(s) 28, 39
HpyCH4V TGCA 2 cut(s) 115, 308
HpyF10VI GCNNNNNNNGC 1 cut(s) 332
HpyF3I CTNAG 2 cut(s) 97, 107
HpySE526I ACGT 2 cut(s) 28, 39
Kzo9I GATC 1 cut(s) 6
LmnI GCTCC 1 cut(s) 275
LpnPI CCDG 8 cut(s) 85, 104, 119, 189, 260, 273, 278, 312
MaeI CTAG 1 cut(s) 336
MaeII ACGT 2 cut(s) 28, 39
MaeIII GTNAC 1 cut(s) 119
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MboII GAAGA 2 cut(s) 31, 118
MluCI AATT 2 cut(s) 13, 196
MlyI GAGTC 1 cut(s) 333
MnlI CCTC 1 cut(s) 89
MseI TTAA 1 cut(s) 300
Mva1269I GAATGC 1 cut(s) 310
MwoI GCNNNNNNNGC 1 cut(s) 332
NdeII GATC 1 cut(s) 6
NlaIV GGNNCC 1 cut(s) 136
NmeAIII GCCGAG 1 cut(s) 60
PctI GAATGC 1 cut(s) 310
PfeI GAWTC 3 cut(s) 22, 169, 229
PleI GAGTC 1 cut(s) 333
PpsI GAGTC 1 cut(s) 333
Ppu21I YACGTR 1 cut(s) 29
Psp1406I AACGTT 1 cut(s) 39
PspN4I GGNNCC 1 cut(s) 136
PspPI GGNCC 1 cut(s) 135
PsrI GAACNNNNNNTAC 2 cut(s) 227, 259
PstNI CAGNNNCTG 1 cut(s) 326
RsaI GTAC 2 cut(s) 245, 282
RsaNI GTAC 2 cut(s) 244, 281
SaqAI TTAA 1 cut(s) 300
Sau3AI GATC 1 cut(s) 6
Sau96I GGNCC 1 cut(s) 135
SchI GAGTC 1 cut(s) 333
SetI ASST 7 cut(s) 31, 42, 98, 113, 121, 186, 249
SmlI CTYRAG 1 cut(s) 224
SmoI CTYRAG 1 cut(s) 224
Sse9I AATT 2 cut(s) 13, 196
SsiI CCGC 1 cut(s) 291
SspMI CTAG 1 cut(s) 336
TaaI ACNGT 1 cut(s) 219
TaiI ACGT 2 cut(s) 31, 42
TaqI TCGA 1 cut(s) 172
TasI AATT 2 cut(s) 13, 196
TfiI GAWTC 3 cut(s) 22, 169, 229
Tru1I TTAA 1 cut(s) 300
Tru9I TTAA 1 cut(s) 300
TspDTI ATGAA 2 cut(s) 135, 167
XapI RAATTY 1 cut(s) 13
XspI CTAG 1 cut(s) 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.