Rmu_sc0004507.1_g000033

transcription regulatory region sequence-specific DNA binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004507.1
Physical Location & Seq
Forward (+)
146609 .. 147253
645 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004507.1_g000033.1.cds

Sequence Viewer

Length: 645 bp
atgccaaccactgaaaacctagggatcaggaggcaggccactctgttcaagaaggctcatcaattgtcagttttatgtgatgcggaggtggcgatcatcgctttcacaagcaatggaaagcttcatgaattctcgagcaccagcatggagcacactctttcgagatacaagggcaaggtggagcagtctaggccagaagagagccgccgccacgaacctgcgaaactggatgagccaaaaccatgtaacaattacattcttcatgaactgaagggaaaacatgcagcgctgagcttggagatctcgcggaggatgggaaaagagttggatgacttgagtagggaagagctgtgtgccctagaggagcaacaactttgggcgttgttatctgtcaatgataagaagaaggaactacttgtggagatgttgcagaggtctatgtcgcgtgatgaacagcgagctgtgcaggagaaagagaacctgatcagagggtttgaggggaggaggagggaaaggccatatgtccttcaagaccatggcctgaataggatggttcacggcacaaaattgaaagctgtttcactttacaatcgtccattacagatcagcgatgagcattccgacatcttgcaactgcggctgtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

214

Amino Acids

24.83

Weight (kDa)

8.72

Isoelectric Point (pI)

57.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018054)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g19060
rosa_chinensis RchiOBHm_Chr3g0474101
rosa_laevigata RLG00000023950
rosa_multiflora Rmu_sc0004507.1_g000033
rosa_roxburghii Rroxscaffold_6G00407480
rosa_rugosa Rorug03G0138800
rosa_samantha Rh3AG188800 Rh3BG218200 Rh3CG213900 Rh3DG213400
rosa_wichuraiana Rw3G017270

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 226
AccII CGCG 2 cut(s) 307, 445
AciI CCGC 5 cut(s) 83, 205, 208, 307, 637
AclWI GGATC 1 cut(s) 32
AcsI RAATTY 1 cut(s) 128
AcuI CTGAAG 1 cut(s) 290
AfeI AGCGCT 1 cut(s) 288
AgsI TTSAA 3 cut(s) 49, 530, 571
AluBI AGCT 5 cut(s) 121, 294, 349, 461, 575
AluI AGCT 5 cut(s) 121, 294, 349, 461, 575
Alw21I GWGCWC 2 cut(s) 140, 153
AlwI GGATC 1 cut(s) 32
Ama87I CYCGRG 1 cut(s) 133
Aor51HI AGCGCT 1 cut(s) 288
AoxI GGCC 4 cut(s) 36, 191, 515, 538
ApeKI GCWGC 1 cut(s) 284
ApoI RAATTY 1 cut(s) 128
AspA2I CCTAGG 1 cut(s) 19
AspLEI GCGC 1 cut(s) 289
AvaI CYCGRG 1 cut(s) 133
AvrII CCTAGG 1 cut(s) 19
BaeGI GKGCMC 1 cut(s) 358
Bbv12I GWGCWC 2 cut(s) 140, 153
BbvI GCAGC 1 cut(s) 296
BccI CCATC 2 cut(s) 307, 544
BceAI ACGGC 1 cut(s) 574
BclI TGATCA 1 cut(s) 483
BfaI CTAG 3 cut(s) 20, 189, 359
BfoI RGCGCY 1 cut(s) 290
BfuAI ACCTGC 1 cut(s) 226
BglII AGATCT 1 cut(s) 300
BisI GCNGC 4 cut(s) 205, 208, 285, 638
BlnI CCTAGG 1 cut(s) 19
BlpI GCTNAGC 1 cut(s) 290
BlsI GCNGC 4 cut(s) 206, 209, 286, 639
BmeT110I CYCGRG 1 cut(s) 133
BmsI GCATC 1 cut(s) 70
Bpu1102I GCTNAGC 1 cut(s) 290
BpuEI CTTGAG 1 cut(s) 355
BsaJI CCNNGG 2 cut(s) 19, 535
Bse1I ACTGG 1 cut(s) 231
Bse3DI GCAATG 1 cut(s) 118
BseDI CCNNGG 2 cut(s) 19, 535
BseGI GGATG 4 cut(s) 235, 318, 334, 555
BseMI GCAATG 1 cut(s) 118
BseMII CTCAG 1 cut(s) 281
BseNI ACTGG 1 cut(s) 231
BseRI GAGGAG 3 cut(s) 377, 517, 520
BseSI GKGCMC 1 cut(s) 358
BseXI GCAGC 1 cut(s) 296
BsgI GTGCAG 1 cut(s) 485
Bsh1236I CGCG 2 cut(s) 307, 445
BshFI GGCC 4 cut(s) 38, 193, 517, 540
BsiHKAI GWGCWC 2 cut(s) 140, 153
BsiHKCI CYCGRG 1 cut(s) 133
BsmI GAATGC 1 cut(s) 616
BsnI GGCC 4 cut(s) 38, 193, 517, 540
BsoBI CYCGRG 1 cut(s) 133
Bsp1286I GDGCHC 3 cut(s) 140, 153, 358
Bsp143I GATC 5 cut(s) 24, 93, 300, 483, 603
Bsp1720I GCTNAGC 1 cut(s) 290
Bsp19I CCATGG 1 cut(s) 535
BspACI CCGC 5 cut(s) 83, 205, 208, 307, 637
BspANI GGCC 4 cut(s) 38, 193, 517, 540
BspCNI CTCAG 1 cut(s) 282
BspFNI CGCG 2 cut(s) 307, 445
BspHI TCATGA 2 cut(s) 124, 262
BspMI ACCTGC 1 cut(s) 226
BspPI GGATC 1 cut(s) 32
BspQI GCTCTTC 1 cut(s) 339
BsrDI GCAATG 1 cut(s) 118
BsrI ACTGG 1 cut(s) 231
BssECI CCNNGG 2 cut(s) 19, 535
BssMI GATC 5 cut(s) 24, 93, 300, 483, 603
BssT1I CCWWGG 2 cut(s) 19, 535
Bst6I CTCTTC 2 cut(s) 192, 339
BstC8I GCNNGC 2 cut(s) 36, 459
BstDEI CTNAG 1 cut(s) 290
BstDSI CCRYGG 1 cut(s) 535
BstF5I GGATG 4 cut(s) 235, 318, 334, 555
BstFNI CGCG 2 cut(s) 307, 445
BstH2I RGCGCY 1 cut(s) 290
BstHHI GCGC 1 cut(s) 289
BstKTI GATC 5 cut(s) 27, 96, 303, 486, 606
BstMBI GATC 5 cut(s) 24, 93, 300, 483, 603
BstMWI GCNNNNNNNGC 5 cut(s) 89, 98, 190, 463, 637
BstNSI RCATGY 1 cut(s) 284
BstSLI GKGCMC 1 cut(s) 358
BstUI CGCG 2 cut(s) 307, 445
BstV1I GCAGC 1 cut(s) 296
BstX2I RGATCY 1 cut(s) 300
BstYI RGATCY 1 cut(s) 300
BsuRI GGCC 4 cut(s) 38, 193, 517, 540
BtgI CCRYGG 1 cut(s) 535
BtgZI GCGATG 2 cut(s) 82, 624
BtsCI GGATG 4 cut(s) 235, 318, 334, 555
BtsIMutI CAGTG 1 cut(s) 9
BveI ACCTGC 1 cut(s) 226
Cac8I GCNNGC 2 cut(s) 36, 459
CciI TCATGA 2 cut(s) 124, 262
CfoI GCGC 1 cut(s) 289
CviAII CATG 6 cut(s) 125, 145, 243, 263, 281, 536
DdeI CTNAG 1 cut(s) 290
DpnI GATC 5 cut(s) 26, 95, 302, 485, 605
DpnII GATC 5 cut(s) 24, 93, 300, 483, 603
Eam1104I CTCTTC 2 cut(s) 192, 339
EarI CTCTTC 2 cut(s) 192, 339
Eco130I CCWWGG 2 cut(s) 19, 535
Eco47III AGCGCT 1 cut(s) 288
Eco57I CTGAAG 1 cut(s) 290
Eco88I CYCGRG 1 cut(s) 133
EcoRI GAATTC 1 cut(s) 128
EcoT14I CCWWGG 2 cut(s) 19, 535
ErhI CCWWGG 2 cut(s) 19, 535
FaeI CATG 6 cut(s) 128, 148, 246, 266, 284, 539
FatI CATG 6 cut(s) 124, 144, 242, 262, 280, 535
FauNDI CATATG 1 cut(s) 520
FbaI TGATCA 1 cut(s) 483
Fnu4HI GCNGC 4 cut(s) 205, 208, 285, 638
FokI GGATG 4 cut(s) 242, 325, 341, 562
Fsp4HI GCNGC 4 cut(s) 205, 208, 285, 638
FspBI CTAG 3 cut(s) 20, 189, 359
GlaI GCGC 1 cut(s) 288
GluI GCNGC 4 cut(s) 205, 208, 285, 638
HaeII RGCGCY 1 cut(s) 290
HaeIII GGCC 4 cut(s) 38, 193, 517, 540
HhaI GCGC 1 cut(s) 289
Hin1II CATG 6 cut(s) 128, 148, 246, 266, 284, 539
Hin6I GCGC 1 cut(s) 287
HinP1I GCGC 1 cut(s) 287
HindIII AAGCTT 1 cut(s) 119
Hpy166II GTNNAC 1 cut(s) 556
Hpy188I TCNGA 2 cut(s) 488, 622
Hpy188III TCNNGA 7 cut(s) 28, 49, 125, 133, 162, 263, 530
Hpy8I GTNNAC 1 cut(s) 556
HpyAV CCTTC 4 cut(s) 46, 265, 400, 536
HpyCH4V TGCA 4 cut(s) 284, 430, 466, 631
HpyF10VI GCNNNNNNNGC 5 cut(s) 89, 98, 190, 463, 637
HpyF3I CTNAG 1 cut(s) 290
Hsp92II CATG 6 cut(s) 128, 148, 246, 266, 284, 539
HspAI GCGC 1 cut(s) 287
Ksp22I TGATCA 1 cut(s) 483
Kzo9I GATC 5 cut(s) 24, 93, 300, 483, 603
LguI GCTCTTC 1 cut(s) 339
LmnI GCTCC 3 cut(s) 148, 181, 364
LpnPI CCDG 9 cut(s) 13, 20, 154, 207, 212, 231, 452, 494, 554
Lsp1109I GCAGC 1 cut(s) 296
LweI GCATC 1 cut(s) 70
MaeI CTAG 3 cut(s) 20, 189, 359
MaeIII GTNAC 1 cut(s) 245
MalI GATC 5 cut(s) 26, 95, 302, 485, 605
MboI GATC 5 cut(s) 24, 93, 300, 483, 603
MboII GAAGA 4 cut(s) 209, 251, 356, 415
MfeI CAATTG 1 cut(s) 62
MflI RGATCY 1 cut(s) 300
MhlI GDGCHC 3 cut(s) 140, 153, 358
MluCI AATT 4 cut(s) 62, 128, 250, 566
MmeI TCCRAC 2 cut(s) 306, 645
MslI CAYNNNNRTG 1 cut(s) 143
MunI CAATTG 1 cut(s) 62
Mva1269I GAATGC 1 cut(s) 616
MvnI CGCG 2 cut(s) 307, 445
MwoI GCNNNNNNNGC 5 cut(s) 89, 98, 190, 463, 637
NcoI CCATGG 1 cut(s) 535
NdeI CATATG 1 cut(s) 520
NdeII GATC 5 cut(s) 24, 93, 300, 483, 603
NlaIII CATG 6 cut(s) 128, 148, 246, 266, 284, 539
NspI RCATGY 1 cut(s) 284
PaeR7I CTCGAG 1 cut(s) 133
PagI TCATGA 2 cut(s) 124, 262
PciSI GCTCTTC 1 cut(s) 339
PctI GAATGC 1 cut(s) 616
PkrI GCNGC 4 cut(s) 206, 209, 286, 639
PsuI RGATCY 1 cut(s) 300
RseI CAYNNNNRTG 1 cut(s) 143
SapI GCTCTTC 1 cut(s) 339
SatI GCNGC 4 cut(s) 205, 208, 285, 638
Sau3AI GATC 5 cut(s) 24, 93, 300, 483, 603
SduI GDGCHC 3 cut(s) 140, 153, 358
SfaNI GCATC 1 cut(s) 70
Sfr274I CTCGAG 1 cut(s) 133
SlaI CTCGAG 1 cut(s) 133
SmiMI CAYNNNNRTG 1 cut(s) 143
SmlI CTYRAG 2 cut(s) 133, 334
SmoI CTYRAG 2 cut(s) 133, 334
Sse9I AATT 4 cut(s) 62, 128, 250, 566
SsiI CCGC 5 cut(s) 83, 205, 208, 307, 637
SspMI CTAG 3 cut(s) 20, 189, 359
StyI CCWWGG 2 cut(s) 19, 535
TaqI TCGA 2 cut(s) 134, 161
TasI AATT 4 cut(s) 62, 128, 250, 566
TauI GCSGC 3 cut(s) 207, 210, 640
TscAI CASTG 1 cut(s) 16
TseI GCWGC 1 cut(s) 284
TspDTI ATGAA 5 cut(s) 113, 141, 251, 279, 465
TspRI CASTG 1 cut(s) 16
XapI RAATTY 1 cut(s) 128
XceI RCATGY 1 cut(s) 284
XhoI CTCGAG 1 cut(s) 133
XmaJI CCTAGG 1 cut(s) 19
XspI CTAG 3 cut(s) 20, 189, 359
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.