Rmu_sc0005257.1_g000015

resistance protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005257.1
Physical Location & Seq
Reverse (-)
92152 .. 92445
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005257.1_g000015.1.cds

Sequence Viewer

Length: 294 bp
atgcgagtggaacttctgtacgagaactatcttgctctattggcatgcttgaaggacttgttctatgtccttgagagattgcaaatatcttgtgtgtcttccaagcagtgtgggtggcttaaaattctcaaagatctcaatctttctggttgctcaaagcttgacaaattgtcggatgagttgggtcatgttgcctgtttggagaagcttgatgtgagtggaagtggcataagagaactgccctcctctattggtcttttgaaaaacctcaaagaattctctcttgctggatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.76

Weight (kDa)

6.55

Isoelectric Point (pI)

35.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020572)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 123, 275
AfaI GTAC 1 cut(s) 20
AgsI TTSAA 2 cut(s) 52, 262
AhdI GACNNNNNGTC 1 cut(s) 169
AluBI AGCT 2 cut(s) 160, 208
AluI AGCT 2 cut(s) 160, 208
ApoI RAATTY 2 cut(s) 123, 275
BbsI GAAGAC 1 cut(s) 90
BglII AGATCT 1 cut(s) 133
BmeRI GACNNNNNGTC 1 cut(s) 169
BpiI GAAGAC 1 cut(s) 90
BpuEI CTTGAG 1 cut(s) 92
BsaBI GATNNNNATC 1 cut(s) 138
Bse8I GATNNNNATC 1 cut(s) 138
BseGI GGATG 1 cut(s) 181
BseJI GATNNNNATC 1 cut(s) 138
BseRI GAGGAG 1 cut(s) 235
Bsp143I GATC 1 cut(s) 133
BssMI GATC 1 cut(s) 133
BstC8I GCNNGC 1 cut(s) 46
BstF5I GGATG 1 cut(s) 181
BstKTI GATC 1 cut(s) 136
BstMBI GATC 1 cut(s) 133
BstMWI GCNNNNNNNGC 1 cut(s) 41
BstNSI RCATGY 1 cut(s) 48
BstV2I GAAGAC 1 cut(s) 90
BstX2I RGATCY 1 cut(s) 133
BstYI RGATCY 1 cut(s) 133
BtsCI GGATG 1 cut(s) 181
BtsI GCAGTG 1 cut(s) 113
BtsIMutI CAGTG 1 cut(s) 113
Cac8I GCNNGC 1 cut(s) 46
Csp6I GTAC 1 cut(s) 19
CspCI CAANNNNNGTGG 2 cut(s) 91, 126
CviAII CATG 2 cut(s) 45, 188
CviJI RGCY 3 cut(s) 118, 160, 208
CviKI_1 RGCY 3 cut(s) 118, 160, 208
CviQI GTAC 1 cut(s) 19
DpnI GATC 1 cut(s) 135
DpnII GATC 1 cut(s) 133
DriI GACNNNNNGTC 1 cut(s) 169
Eam1105I GACNNNNNGTC 1 cut(s) 169
EcoRI GAATTC 1 cut(s) 275
FaeI CATG 2 cut(s) 48, 191
FaiI YATR 4 cut(s) 46, 66, 189, 230
FatI CATG 2 cut(s) 44, 187
FokI GGATG 1 cut(s) 188
Hin1II CATG 2 cut(s) 48, 191
HindIII AAGCTT 2 cut(s) 158, 206
Hpy188I TCNGA 1 cut(s) 175
HpyAV CCTTC 1 cut(s) 46
HpyCH4V TGCA 1 cut(s) 82
HpyF10VI GCNNNNNNNGC 1 cut(s) 41
Hsp92II CATG 2 cut(s) 48, 191
Kzo9I GATC 1 cut(s) 133
LpnPI CCDG 3 cut(s) 132, 208, 273
MalI GATC 1 cut(s) 135
MboI GATC 1 cut(s) 133
MboII GAAGA 1 cut(s) 90
MflI RGATCY 1 cut(s) 133
MluCI AATT 3 cut(s) 123, 167, 275
MmeI TCCRAC 1 cut(s) 153
MnlI CCTC 3 cut(s) 253, 256, 278
MseI TTAA 1 cut(s) 120
MwoI GCNNNNNNNGC 1 cut(s) 41
NdeII GATC 1 cut(s) 133
NlaIII CATG 2 cut(s) 48, 191
NspI RCATGY 1 cut(s) 48
PaeI GCATGC 1 cut(s) 48
PsuI RGATCY 1 cut(s) 133
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
SaqAI TTAA 1 cut(s) 120
Sau3AI GATC 1 cut(s) 133
SetI ASST 3 cut(s) 162, 210, 270
SmlI CTYRAG 1 cut(s) 71
SmoI CTYRAG 1 cut(s) 71
SphI GCATGC 1 cut(s) 48
Sse9I AATT 3 cut(s) 123, 167, 275
TasI AATT 3 cut(s) 123, 167, 275
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TscAI CASTG 1 cut(s) 113
TspRI CASTG 1 cut(s) 113
XapI RAATTY 2 cut(s) 123, 275
XceI RCATGY 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.