Rmu_sc0005914.1_g000006

Belongs to the short-chain dehydrogenases reductases (SDR) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005914.1
OG0022586
Physical Location & Seq
Reverse (-)
26712 .. 28050
1339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005914.1_g000006.1.cds

Sequence Viewer

Length: 528 bp
atggcagaaggagcaaagaggcgtgcagttgttacaggttcaaatcaagggattggatttggaacagttacgctattggcttccgaaggggtcaaggttgtgctaactgctttggatgagaagagaggtcttgaagctattgaaaagctaaaagactatggcttctcagatcttgtggtttatcatcagctcgatgtaactgacccaatagcattgctttccttgccgattttgtcaaaacccaatttgggaaactcgatatcttggtatgccaacatatggattggtggaacctttgtagaccctgaagctttcaaagctgctgcagctgcaggcatggataaggatgatgtagtagtcaacttgagtaaactaatcactcaaacatatgagttagctgaagaatgtgtgaaaataaactactatggtgccaagaaaatgactgaagcattccttcctctccttcagctatctgattctccaagagtttccaatattacttctggcctgggacagttaacgatatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00902 ko01110 map00902 map01110
Pfam Domains
Protein Families
adh_short adh_short_C2

Protein Analysis

175

Amino Acids

18.81

Weight (kDa)

5.02

Isoelectric Point (pI)

33.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022586)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0353561
rosa_multiflora Rmu_sc0005914.1_g000006
rosa_samantha Rh1BG218700 Rh1DG245100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 428
AccB7I CCANNNNNTGG 1 cut(s) 279
AccI GTMKAC 1 cut(s) 300
AcuI CTGAAG 4 cut(s) 327, 420, 449, 465
AfiI CCNNNNNNNGG 2 cut(s) 248, 279
AgsI TTSAA 4 cut(s) 42, 134, 143, 316
AjnI CCWGG 1 cut(s) 507
AluBI AGCT 8 cut(s) 137, 148, 190, 311, 320, 329, 398, 469
AluI AGCT 8 cut(s) 137, 148, 190, 311, 320, 329, 398, 469
AoxI GGCC 1 cut(s) 505
ApeKI GCWGC 4 cut(s) 320, 323, 326, 329
BanI GGYRCC 1 cut(s) 428
BbvI GCAGC 4 cut(s) 307, 310, 316, 338
BciT130I CCWGG 1 cut(s) 509
BfmI CTRYAG 2 cut(s) 324, 330
BglII AGATCT 1 cut(s) 169
BisI GCNGC 4 cut(s) 321, 324, 327, 330
BlsI GCNGC 4 cut(s) 322, 325, 328, 331
Bme1390I CCNGG 1 cut(s) 509
BmiI GGNNCC 2 cut(s) 292, 430
BmrFI CCNGG 1 cut(s) 509
BpuEI CTTGAG 1 cut(s) 385
BsaJI CCNNGG 1 cut(s) 508
Bsc4I CCNNNNNNNGG 2 cut(s) 248, 279
Bse3DI GCAATG 1 cut(s) 212
BseBI CCWGG 1 cut(s) 509
BseDI CCNNGG 1 cut(s) 508
BseGI GGATG 2 cut(s) 121, 352
BseLI CCNNNNNNNGG 2 cut(s) 248, 279
BseMI GCAATG 1 cut(s) 212
BseMII CTCAG 1 cut(s) 180
BseXI GCAGC 4 cut(s) 307, 310, 316, 338
BsgI GTGCAG 1 cut(s) 45
BshFI GGCC 1 cut(s) 507
BshNI GGYRCC 1 cut(s) 428
BslI CCNNNNNNNGG 2 cut(s) 248, 279
BsmI GAATGC 1 cut(s) 449
BsnI GGCC 1 cut(s) 507
Bsp143I GATC 1 cut(s) 169
BspANI GGCC 1 cut(s) 507
BspCNI CTCAG 1 cut(s) 179
BspLI GGNNCC 2 cut(s) 292, 430
BspMAI CTGCAG 2 cut(s) 328, 334
BspT107I GGYRCC 1 cut(s) 428
BsrDI GCAATG 1 cut(s) 212
BssECI CCNNGG 1 cut(s) 508
BssMI GATC 1 cut(s) 169
Bst2UI CCWGG 1 cut(s) 509
Bst4CI ACNGT 2 cut(s) 67, 516
Bst6I CTCTTC 1 cut(s) 116
BstC8I GCNNGC 2 cut(s) 24, 334
BstDEI CTNAG 1 cut(s) 166
BstF5I GGATG 2 cut(s) 121, 352
BstKTI GATC 1 cut(s) 172
BstMBI GATC 1 cut(s) 169
BstMWI GCNNNNNNNGC 5 cut(s) 11, 223, 317, 326, 329
BstNI CCWGG 1 cut(s) 509
BstSCI CCNGG 1 cut(s) 507
BstSFI CTRYAG 2 cut(s) 324, 330
BstV1I GCAGC 4 cut(s) 307, 310, 316, 338
BstX2I RGATCY 1 cut(s) 169
BstYI RGATCY 1 cut(s) 169
BsuRI GGCC 1 cut(s) 507
BtsCI GGATG 2 cut(s) 121, 352
Cac8I GCNNGC 2 cut(s) 24, 334
CviAII CATG 1 cut(s) 337
DdeI CTNAG 1 cut(s) 166
DpnI GATC 1 cut(s) 171
DpnII GATC 1 cut(s) 169
Eam1104I CTCTTC 1 cut(s) 116
EarI CTCTTC 1 cut(s) 116
Eco32I GATATC 1 cut(s) 261
Eco57I CTGAAG 4 cut(s) 327, 420, 449, 465
EcoRII CCWGG 1 cut(s) 507
EcoRV GATATC 1 cut(s) 261
FaeI CATG 1 cut(s) 340
FaiI YATR 9 cut(s) 159, 270, 278, 280, 338, 388, 390, 426, 526
FalI AAGNNNNNCTT 2 cut(s) 438, 470
FatI CATG 1 cut(s) 336
FauNDI CATATG 2 cut(s) 278, 388
FblI GTMKAC 1 cut(s) 300
Fnu4HI GCNGC 4 cut(s) 321, 324, 327, 330
FokI GGATG 2 cut(s) 128, 359
Fsp4HI GCNGC 4 cut(s) 321, 324, 327, 330
GluI GCNGC 4 cut(s) 321, 324, 327, 330
HaeIII GGCC 1 cut(s) 507
Hin1II CATG 1 cut(s) 340
HincII GTYRAC 2 cut(s) 361, 519
HindII GTYRAC 2 cut(s) 361, 519
HindIII AAGCTT 1 cut(s) 309
HinfI GANTC 1 cut(s) 476
HpaI GTTAAC 1 cut(s) 519
Hpy166II GTNNAC 4 cut(s) 301, 361, 371, 519
Hpy188I TCNGA 3 cut(s) 85, 169, 475
Hpy188III TCNNGA 1 cut(s) 131
Hpy8I GTNNAC 4 cut(s) 301, 361, 371, 519
HpyAV CCTTC 3 cut(s) 80, 464, 473
HpyCH4III ACNGT 2 cut(s) 67, 516
HpyCH4V TGCA 3 cut(s) 26, 326, 332
HpyF10VI GCNNNNNNNGC 5 cut(s) 11, 223, 317, 326, 329
HpyF3I CTNAG 1 cut(s) 166
Hsp92II CATG 1 cut(s) 340
KspAI GTTAAC 1 cut(s) 519
Kzo9I GATC 1 cut(s) 169
LmnI GCTCC 1 cut(s) 11
LpnPI CCDG 6 cut(s) 21, 318, 318, 489, 494, 521
Lsp1109I GCAGC 4 cut(s) 307, 310, 316, 338
MaeIII GTNAC 3 cut(s) 31, 67, 196
MalI GATC 1 cut(s) 171
MboI GATC 1 cut(s) 169
MboII GAAGA 2 cut(s) 133, 413
MflI RGATCY 1 cut(s) 169
MluCI AATT 1 cut(s) 244
MnlI CCTC 3 cut(s) 12, 119, 468
MseI TTAA 1 cut(s) 518
MspA1I CMGCKG 1 cut(s) 329
MspR9I CCNGG 1 cut(s) 509
Mva1269I GAATGC 1 cut(s) 449
MvaI CCWGG 1 cut(s) 509
MwoI GCNNNNNNNGC 5 cut(s) 11, 223, 317, 326, 329
NdeI CATATG 2 cut(s) 278, 388
NdeII GATC 1 cut(s) 169
NlaIII CATG 1 cut(s) 340
NlaIV GGNNCC 2 cut(s) 292, 430
PctI GAATGC 1 cut(s) 449
PfeI GAWTC 1 cut(s) 476
PflMI CCANNNNNTGG 1 cut(s) 279
PkrI GCNGC 4 cut(s) 322, 325, 328, 331
Psp6I CCWGG 1 cut(s) 507
PspGI CCWGG 1 cut(s) 507
PspN4I GGNNCC 2 cut(s) 292, 430
PstI CTGCAG 2 cut(s) 328, 334
PsuI RGATCY 1 cut(s) 169
PvuII CAGCTG 1 cut(s) 329
SaqAI TTAA 1 cut(s) 518
SatI GCNGC 4 cut(s) 321, 324, 327, 330
Sau3AI GATC 1 cut(s) 169
ScrFI CCNGG 1 cut(s) 509
SfcI CTRYAG 2 cut(s) 324, 330
SmlI CTYRAG 1 cut(s) 364
SmoI CTYRAG 1 cut(s) 364
Sse9I AATT 1 cut(s) 244
SspI AATATT 1 cut(s) 496
StyD4I CCNGG 1 cut(s) 507
TaaI ACNGT 2 cut(s) 67, 516
TaqI TCGA 2 cut(s) 192, 257
TasI AATT 1 cut(s) 244
TfiI GAWTC 1 cut(s) 476
Tru1I TTAA 1 cut(s) 518
Tru9I TTAA 1 cut(s) 518
TseI GCWGC 4 cut(s) 320, 323, 326, 329
Van91I CCANNNNNTGG 1 cut(s) 279
XmiI GTMKAC 1 cut(s) 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.