Rmu_sc0005950.1_g000001

Belongs to the short-chain dehydrogenases reductases (SDR) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005950.1
OG0025602
Physical Location & Seq
Forward (+)
1 .. 2170
2170 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005950.1_g000001.1.cds

Sequence Viewer

Length: 358 bp
aatttgtgttgtcaccggggccaacaaagggattggatttgagatatgcaggcaactagcttctaatgggatcctggtagtattaactgcaagagatgtgaagagcggacaagaagctgtcgaaaagctcaagctttctggcttgactgatgtaatttttcatcaactagatgtaaccgatgcaactagcattgcttctttagcagatttcatcgaatcccagttcgggaagcttgacatattggtcaacaatgcaggagttaacggaatcagagtgatcggagggaatgcaaagaacataacttttgattatgagcatgtaagtttatgtaatatagagagagagagacattcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00902 ko01110 map00902 map01110
Pfam Domains
Protein Families
adh_short adh_short_C2

Protein Analysis

118

Amino Acids

12.69

Weight (kDa)

5.52

Isoelectric Point (pI)

26.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025602)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0005950.1_g000001 Rmu_sc0007215.1_g000013 Rmu_sc0030063.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 243
AccBSI CCGCTC 1 cut(s) 106
AciI CCGC 1 cut(s) 106
AclWI GGATC 2 cut(s) 65, 78
AfiI CCNNNNNNNGG 2 cut(s) 28, 226
AjnI CCWGG 1 cut(s) 73
AluBI AGCT 5 cut(s) 60, 117, 128, 134, 233
AluI AGCT 5 cut(s) 60, 117, 128, 134, 233
Alw26I GTCTC 1 cut(s) 341
AlwI GGATC 2 cut(s) 65, 78
AoxI GGCC 1 cut(s) 19
AspS9I GGNCC 1 cut(s) 19
AsuC2I CCSGG 1 cut(s) 17
AsuHPI GGTGA 1 cut(s) 5
BamHI GGATCC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 75
BcnI CCSGG 1 cut(s) 17
BcoDI GTCTC 1 cut(s) 341
BfaI CTAG 3 cut(s) 57, 168, 187
Bme1390I CCNGG 2 cut(s) 17, 75
BmgT120I GGNCC 1 cut(s) 19
BmiI GGNNCC 2 cut(s) 20, 72
BmrFI CCNGG 2 cut(s) 17, 75
BmrI ACTGGG 1 cut(s) 215
BmsI GCATC 1 cut(s) 170
BmuI ACTGGG 1 cut(s) 215
BpuEI CTTGAG 1 cut(s) 114
BpuMI CCSGG 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 16
Bsc4I CCNNNNNNNGG 2 cut(s) 28, 226
Bse1I ACTGG 1 cut(s) 221
Bse3DI GCAATG 1 cut(s) 190
BseBI CCWGG 1 cut(s) 75
BseDI CCNNGG 1 cut(s) 16
BseLI CCNNNNNNNGG 2 cut(s) 28, 226
BseMI GCAATG 1 cut(s) 190
BseNI ACTGG 1 cut(s) 221
BshFI GGCC 1 cut(s) 21
BsiSI CCGG 1 cut(s) 16
BslI CCNNNNNNNGG 2 cut(s) 28, 226
BsmAI GTCTC 1 cut(s) 341
BsmI GAATGC 1 cut(s) 293
BsnI GGCC 1 cut(s) 21
Bsp143I GATC 2 cut(s) 70, 277
BspACI CCGC 1 cut(s) 106
BspANI GGCC 1 cut(s) 21
BspLI GGNNCC 2 cut(s) 20, 72
BspPI GGATC 2 cut(s) 65, 78
BspQI GCTCTTC 1 cut(s) 96
BsrBI CCGCTC 1 cut(s) 106
BsrDI GCAATG 1 cut(s) 190
BsrI ACTGG 1 cut(s) 221
BssECI CCNNGG 1 cut(s) 16
BssMI GATC 2 cut(s) 70, 277
Bst2UI CCWGG 1 cut(s) 75
Bst6I CTCTTC 1 cut(s) 96
BstC8I GCNNGC 1 cut(s) 51
BstKTI GATC 2 cut(s) 73, 280
BstMAI GTCTC 1 cut(s) 341
BstMBI GATC 2 cut(s) 70, 277
BstMWI GCNNNNNNNGC 1 cut(s) 201
BstNI CCWGG 1 cut(s) 75
BstNSI RCATGY 1 cut(s) 321
BstSCI CCNGG 2 cut(s) 15, 73
BstX2I RGATCY 1 cut(s) 70
BstYI RGATCY 1 cut(s) 70
BsuRI GGCC 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 51
Cfr13I GGNCC 1 cut(s) 19
CviAII CATG 1 cut(s) 318
CviJI RGCY 7 cut(s) 21, 60, 117, 128, 134, 142, 233
CviKI_1 RGCY 7 cut(s) 21, 60, 117, 128, 134, 142, 233
DpnI GATC 2 cut(s) 72, 279
DpnII GATC 2 cut(s) 70, 277
DrdI GACNNNNNNGTC 1 cut(s) 243
DseDI GACNNNNNNGTC 1 cut(s) 243
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
EcoRII CCWGG 1 cut(s) 73
FaeI CATG 1 cut(s) 321
FaiI YATR 7 cut(s) 47, 240, 300, 313, 319, 329, 336
FatI CATG 1 cut(s) 317
FspBI CTAG 3 cut(s) 57, 168, 187
HaeIII GGCC 1 cut(s) 21
HapII CCGG 1 cut(s) 16
Hin1II CATG 1 cut(s) 321
HincII GTYRAC 2 cut(s) 248, 263
HindII GTYRAC 2 cut(s) 248, 263
HindIII AAGCTT 2 cut(s) 132, 231
HinfI GANTC 2 cut(s) 216, 268
HpaI GTTAAC 1 cut(s) 263
HpaII CCGG 1 cut(s) 16
HphI GGTGA 1 cut(s) 5
Hpy166II GTNNAC 2 cut(s) 248, 263
Hpy188I TCNGA 2 cut(s) 273, 282
Hpy188III TCNNGA 1 cut(s) 227
Hpy8I GTNNAC 2 cut(s) 248, 263
HpyCH4V TGCA 5 cut(s) 49, 90, 183, 255, 291
HpyF10VI GCNNNNNNNGC 1 cut(s) 201
Hsp92II CATG 1 cut(s) 321
KspAI GTTAAC 1 cut(s) 263
Kzo9I GATC 2 cut(s) 70, 277
LguI GCTCTTC 1 cut(s) 96
LpnPI CCDG 7 cut(s) 29, 35, 60, 87, 124, 234, 241
LweI GCATC 1 cut(s) 170
MaeI CTAG 3 cut(s) 57, 168, 187
MaeIII GTNAC 2 cut(s) 11, 173
MalI GATC 2 cut(s) 72, 279
MbiI CCGCTC 1 cut(s) 106
MboI GATC 2 cut(s) 70, 277
MboII GAAGA 1 cut(s) 113
MflI RGATCY 1 cut(s) 70
MluCI AATT 1 cut(s) 154
MnlI CCTC 1 cut(s) 276
MseI TTAA 3 cut(s) 84, 262, 356
MspI CCGG 1 cut(s) 16
MspR9I CCNGG 2 cut(s) 17, 75
Mva1269I GAATGC 1 cut(s) 293
MvaI CCWGG 1 cut(s) 75
MwoI GCNNNNNNNGC 1 cut(s) 201
NciI CCSGG 1 cut(s) 17
NdeII GATC 2 cut(s) 70, 277
NlaIII CATG 1 cut(s) 321
NlaIV GGNNCC 2 cut(s) 20, 72
NmuCI GTSAC 1 cut(s) 11
NspI RCATGY 1 cut(s) 321
PciSI GCTCTTC 1 cut(s) 96
PctI GAATGC 1 cut(s) 293
PfeI GAWTC 2 cut(s) 216, 268
Psp6I CCWGG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 73
PspN4I GGNNCC 2 cut(s) 20, 72
PspPI GGNCC 1 cut(s) 19
PsuI RGATCY 1 cut(s) 70
SapI GCTCTTC 1 cut(s) 96
SaqAI TTAA 3 cut(s) 84, 262, 356
Sau3AI GATC 2 cut(s) 70, 277
Sau96I GGNCC 1 cut(s) 19
ScrFI CCNGG 2 cut(s) 17, 75
SetI ASST 5 cut(s) 62, 119, 130, 136, 235
SfaNI GCATC 1 cut(s) 170
SmlI CTYRAG 1 cut(s) 129
SmoI CTYRAG 1 cut(s) 129
Sse9I AATT 1 cut(s) 154
SsiI CCGC 1 cut(s) 106
SspMI CTAG 3 cut(s) 57, 168, 187
StyD4I CCNGG 2 cut(s) 15, 73
TaqI TCGA 2 cut(s) 121, 214
TasI AATT 1 cut(s) 154
TfiI GAWTC 2 cut(s) 216, 268
Tru1I TTAA 3 cut(s) 84, 262, 356
Tru9I TTAA 3 cut(s) 84, 262, 356
TseFI GTSAC 1 cut(s) 11
Tsp45I GTSAC 1 cut(s) 11
TspDTI ATGAA 2 cut(s) 150, 200
TspGWI ACGGA 1 cut(s) 280
XceI RCATGY 1 cut(s) 321
XspI CTAG 3 cut(s) 57, 168, 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.