Rmu_sc0030063.1_g000001

Belongs to the short-chain dehydrogenases reductases (SDR) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0030063.1
OG0025602
Physical Location & Seq
Forward (+)
805 .. 1833
1029 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0030063.1_g000001.1.cds

Sequence Viewer

Length: 393 bp
atggccgaaacaaccaacgattctcagtcaaagagaatttgtgttgtcaccggggccaacaaagggattggatttgagatatgcaggcaactagcttctaatgggatcctggtagtattaactgcaagagatgtgaagagcggacaagaagctgtcgaaaagctcaagctttctggcttgactgatgtaatttttcatcaactagatgtaaccgatgcaactagcattgcttctttagcagatttcatcgaatcccagttcgggaagcttgacatattggtcaacaatgcaggagttagcggaatcacagtgatcggagggaatgcaaagaacataacttttgattatgagcatgtaagtttatgtaatatagagagagagagacattcttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00902 ko01110 map00902 map01110
Pfam Domains
Protein Families
adh_short adh_short_C2

Protein Analysis

130

Amino Acids

13.95

Weight (kDa)

5.27

Isoelectric Point (pI)

34.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025602)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0005950.1_g000001 Rmu_sc0007215.1_g000013 Rmu_sc0030063.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 278
AccBSI CCGCTC 1 cut(s) 141
AciI CCGC 2 cut(s) 141, 300
AclWI GGATC 2 cut(s) 100, 113
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 36
AfiI CCNNNNNNNGG 2 cut(s) 63, 261
AjnI CCWGG 1 cut(s) 108
AluBI AGCT 5 cut(s) 95, 152, 163, 169, 268
AluI AGCT 5 cut(s) 95, 152, 163, 169, 268
Alw26I GTCTC 1 cut(s) 376
AlwI GGATC 2 cut(s) 100, 113
AoxI GGCC 2 cut(s) 3, 54
ApoI RAATTY 1 cut(s) 36
AspS9I GGNCC 1 cut(s) 54
AsuC2I CCSGG 1 cut(s) 52
AsuHPI GGTGA 1 cut(s) 40
BamHI GGATCC 1 cut(s) 105
BciT130I CCWGG 1 cut(s) 110
BcnI CCSGG 1 cut(s) 52
BcoDI GTCTC 1 cut(s) 376
BfaI CTAG 3 cut(s) 92, 203, 222
Bme1390I CCNGG 2 cut(s) 52, 110
BmgT120I GGNCC 1 cut(s) 54
BmiI GGNNCC 2 cut(s) 55, 107
BmrFI CCNGG 2 cut(s) 52, 110
BmrI ACTGGG 1 cut(s) 250
BmsI GCATC 1 cut(s) 205
BmuI ACTGGG 1 cut(s) 250
BpuEI CTTGAG 1 cut(s) 149
BpuMI CCSGG 1 cut(s) 52
BsaJI CCNNGG 1 cut(s) 51
Bsc4I CCNNNNNNNGG 2 cut(s) 63, 261
Bse1I ACTGG 1 cut(s) 256
Bse3DI GCAATG 1 cut(s) 225
BseBI CCWGG 1 cut(s) 110
BseDI CCNNGG 1 cut(s) 51
BseLI CCNNNNNNNGG 2 cut(s) 63, 261
BseMI GCAATG 1 cut(s) 225
BseMII CTCAG 1 cut(s) 38
BseNI ACTGG 1 cut(s) 256
BshFI GGCC 2 cut(s) 5, 56
BsiSI CCGG 1 cut(s) 51
BslI CCNNNNNNNGG 2 cut(s) 63, 261
BsmAI GTCTC 1 cut(s) 376
BsmI GAATGC 1 cut(s) 328
BsnI GGCC 2 cut(s) 5, 56
Bsp143I GATC 2 cut(s) 105, 312
BspACI CCGC 2 cut(s) 141, 300
BspANI GGCC 2 cut(s) 5, 56
BspCNI CTCAG 1 cut(s) 37
BspLI GGNNCC 2 cut(s) 55, 107
BspPI GGATC 2 cut(s) 100, 113
BspQI GCTCTTC 1 cut(s) 131
BsrBI CCGCTC 1 cut(s) 141
BsrDI GCAATG 1 cut(s) 225
BsrI ACTGG 1 cut(s) 256
BssECI CCNNGG 1 cut(s) 51
BssMI GATC 2 cut(s) 105, 312
Bst2UI CCWGG 1 cut(s) 110
Bst4CI ACNGT 1 cut(s) 310
Bst6I CTCTTC 1 cut(s) 131
BstC8I GCNNGC 1 cut(s) 86
BstDEI CTNAG 1 cut(s) 24
BstKTI GATC 2 cut(s) 108, 315
BstMAI GTCTC 1 cut(s) 376
BstMBI GATC 2 cut(s) 105, 312
BstMWI GCNNNNNNNGC 1 cut(s) 236
BstNI CCWGG 1 cut(s) 110
BstNSI RCATGY 1 cut(s) 356
BstSCI CCNGG 2 cut(s) 50, 108
BstX2I RGATCY 1 cut(s) 105
BstYI RGATCY 1 cut(s) 105
BsuRI GGCC 2 cut(s) 5, 56
BtsIMutI CAGTG 1 cut(s) 315
Cac8I GCNNGC 1 cut(s) 86
Cfr13I GGNCC 1 cut(s) 54
CviAII CATG 1 cut(s) 353
CviJI RGCY 8 cut(s) 5, 56, 95, 152, 163, 169, 177, 268
CviKI_1 RGCY 8 cut(s) 5, 56, 95, 152, 163, 169, 177, 268
DdeI CTNAG 1 cut(s) 24
DpnI GATC 2 cut(s) 107, 314
DpnII GATC 2 cut(s) 105, 312
DrdI GACNNNNNNGTC 1 cut(s) 278
DseDI GACNNNNNNGTC 1 cut(s) 278
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 131
EarI CTCTTC 1 cut(s) 131
EcoRII CCWGG 1 cut(s) 108
FaeI CATG 1 cut(s) 356
FaiI YATR 7 cut(s) 82, 275, 335, 348, 354, 364, 371
FatI CATG 1 cut(s) 352
FspBI CTAG 3 cut(s) 92, 203, 222
HaeIII GGCC 2 cut(s) 5, 56
HapII CCGG 1 cut(s) 51
Hin1II CATG 1 cut(s) 356
HincII GTYRAC 1 cut(s) 283
HindII GTYRAC 1 cut(s) 283
HindIII AAGCTT 2 cut(s) 167, 266
HinfI GANTC 3 cut(s) 20, 251, 303
HpaII CCGG 1 cut(s) 51
HphI GGTGA 1 cut(s) 40
Hpy166II GTNNAC 1 cut(s) 283
Hpy188I TCNGA 1 cut(s) 317
Hpy188III TCNNGA 1 cut(s) 262
Hpy8I GTNNAC 1 cut(s) 283
HpyCH4III ACNGT 1 cut(s) 310
HpyCH4V TGCA 5 cut(s) 84, 125, 218, 290, 326
HpyF10VI GCNNNNNNNGC 1 cut(s) 236
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 1 cut(s) 356
Kzo9I GATC 2 cut(s) 105, 312
LguI GCTCTTC 1 cut(s) 131
LpnPI CCDG 7 cut(s) 64, 70, 95, 122, 159, 269, 276
LweI GCATC 1 cut(s) 205
MaeI CTAG 3 cut(s) 92, 203, 222
MaeIII GTNAC 2 cut(s) 46, 208
MalI GATC 2 cut(s) 107, 314
MbiI CCGCTC 1 cut(s) 141
MboI GATC 2 cut(s) 105, 312
MboII GAAGA 1 cut(s) 148
MflI RGATCY 1 cut(s) 105
MluCI AATT 2 cut(s) 36, 189
MnlI CCTC 1 cut(s) 311
MseI TTAA 2 cut(s) 119, 391
MspI CCGG 1 cut(s) 51
MspR9I CCNGG 2 cut(s) 52, 110
Mva1269I GAATGC 1 cut(s) 328
MvaI CCWGG 1 cut(s) 110
MwoI GCNNNNNNNGC 1 cut(s) 236
NciI CCSGG 1 cut(s) 52
NdeII GATC 2 cut(s) 105, 312
NlaIII CATG 1 cut(s) 356
NlaIV GGNNCC 2 cut(s) 55, 107
NmuCI GTSAC 1 cut(s) 46
NspI RCATGY 1 cut(s) 356
PciSI GCTCTTC 1 cut(s) 131
PctI GAATGC 1 cut(s) 328
PfeI GAWTC 3 cut(s) 20, 251, 303
Psp6I CCWGG 1 cut(s) 108
PspGI CCWGG 1 cut(s) 108
PspN4I GGNNCC 2 cut(s) 55, 107
PspPI GGNCC 1 cut(s) 54
PsuI RGATCY 1 cut(s) 105
SapI GCTCTTC 1 cut(s) 131
SaqAI TTAA 2 cut(s) 119, 391
Sau3AI GATC 2 cut(s) 105, 312
Sau96I GGNCC 1 cut(s) 54
ScrFI CCNGG 2 cut(s) 52, 110
SetI ASST 5 cut(s) 97, 154, 165, 171, 270
SfaNI GCATC 1 cut(s) 205
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
Sse9I AATT 2 cut(s) 36, 189
SsiI CCGC 2 cut(s) 141, 300
SspMI CTAG 3 cut(s) 92, 203, 222
StyD4I CCNGG 2 cut(s) 50, 108
TaaI ACNGT 1 cut(s) 310
TaqI TCGA 2 cut(s) 156, 249
TasI AATT 2 cut(s) 36, 189
TfiI GAWTC 3 cut(s) 20, 251, 303
Tru1I TTAA 2 cut(s) 119, 391
Tru9I TTAA 2 cut(s) 119, 391
TscAI CASTG 1 cut(s) 315
TseFI GTSAC 1 cut(s) 46
Tsp45I GTSAC 1 cut(s) 46
TspDTI ATGAA 2 cut(s) 185, 235
TspRI CASTG 1 cut(s) 315
XapI RAATTY 1 cut(s) 36
XceI RCATGY 1 cut(s) 356
XspI CTAG 3 cut(s) 92, 203, 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.