Rmu_sc0007215.1_g000013

Salutaridine reductase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007215.1
OG0025602
Physical Location & Seq
Forward (+)
65852 .. 67274
1423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007215.1_g000013.1.cds

Sequence Viewer

Length: 567 bp
atggccgaaacaagcatcgattctcagtcaaagagaatttgtgttgtcaccggggccaacaaagggattggatttgagatatgcaggcaactagcttctaatgggatcctggtagtattaactgcaagagatgtgaagagcggacaagaagctgtcgaaaagctcaagctttctggcttgactgatgtaatttttcatcaactagatgtaaccgatgcaactagcattgcttctttagcagatttcatcgaatcccagttcgggaagcttgacatattggtcaacaatgcaggagttaacggaatcagagtgatcggagggaatgcaaagaacataacttttgattatgagcatatgtttggttcaaaagctggagacttgaaaaagcatctagagcaaacatacgaaagtgcagagaaatgtctgaaaacgaactactatggaatcaagcaaatgagcaaagcaactattcgacttctgcaaaaatctggttcacctaaaatggtcaatgtctcttccatcggaggacagttaaaggtacaaaactggattcaactccttaattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00902 ko01110 map00902 map01110
Pfam Domains
Protein Families
adh_short adh_short_C2

Protein Analysis

188

Amino Acids

20.44

Weight (kDa)

8.93

Isoelectric Point (pI)

31.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025602)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0005950.1_g000001 Rmu_sc0007215.1_g000013 Rmu_sc0030063.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 278
AccBSI CCGCTC 1 cut(s) 141
AciI CCGC 1 cut(s) 141
AclWI GGATC 2 cut(s) 100, 113
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 36
AfaI GTAC 1 cut(s) 540
AfiI CCNNNNNNNGG 2 cut(s) 63, 261
AgsI TTSAA 3 cut(s) 366, 382, 554
AjnI CCWGG 1 cut(s) 108
AluBI AGCT 6 cut(s) 95, 152, 163, 169, 268, 371
AluI AGCT 6 cut(s) 95, 152, 163, 169, 268, 371
Alw26I GTCTC 2 cut(s) 369, 517
AlwI GGATC 2 cut(s) 100, 113
AoxI GGCC 2 cut(s) 3, 54
ApoI RAATTY 1 cut(s) 36
AspS9I GGNCC 1 cut(s) 54
AsuC2I CCSGG 1 cut(s) 52
AsuHPI GGTGA 2 cut(s) 40, 486
BamHI GGATCC 1 cut(s) 105
BccI CCATC 1 cut(s) 527
BciT130I CCWGG 1 cut(s) 110
BcnI CCSGG 1 cut(s) 52
BcoDI GTCTC 2 cut(s) 369, 517
BfaI CTAG 4 cut(s) 92, 203, 222, 392
Bme1390I CCNGG 2 cut(s) 52, 110
BmgT120I GGNCC 1 cut(s) 54
BmiI GGNNCC 2 cut(s) 55, 107
BmrFI CCNGG 2 cut(s) 52, 110
BmrI ACTGGG 1 cut(s) 250
BmsI GCATC 3 cut(s) 24, 205, 397
BmuI ACTGGG 1 cut(s) 250
BpmI CTGGAG 1 cut(s) 393
BpuEI CTTGAG 1 cut(s) 149
BpuMI CCSGG 1 cut(s) 52
Bsa29I ATCGAT 1 cut(s) 18
BsaJI CCNNGG 1 cut(s) 51
Bsc4I CCNNNNNNNGG 2 cut(s) 63, 261
Bse1I ACTGG 2 cut(s) 256, 551
Bse3DI GCAATG 1 cut(s) 225
BseBI CCWGG 1 cut(s) 110
BseCI ATCGAT 1 cut(s) 18
BseDI CCNNGG 1 cut(s) 51
BseLI CCNNNNNNNGG 2 cut(s) 63, 261
BseMI GCAATG 1 cut(s) 225
BseMII CTCAG 1 cut(s) 38
BseNI ACTGG 2 cut(s) 256, 551
BsgI GTGCAG 1 cut(s) 432
BshFI GGCC 2 cut(s) 5, 56
BshVI ATCGAT 1 cut(s) 18
BsiSI CCGG 1 cut(s) 51
BslI CCNNNNNNNGG 2 cut(s) 63, 261
BsmAI GTCTC 2 cut(s) 369, 517
BsmI GAATGC 1 cut(s) 328
BsnI GGCC 2 cut(s) 5, 56
Bsp143I GATC 2 cut(s) 105, 312
BspACI CCGC 1 cut(s) 141
BspANI GGCC 2 cut(s) 5, 56
BspCNI CTCAG 1 cut(s) 37
BspDI ATCGAT 1 cut(s) 18
BspLI GGNNCC 2 cut(s) 55, 107
BspPI GGATC 2 cut(s) 100, 113
BspQI GCTCTTC 1 cut(s) 131
BsrBI CCGCTC 1 cut(s) 141
BsrDI GCAATG 1 cut(s) 225
BsrI ACTGG 2 cut(s) 256, 551
BssECI CCNNGG 1 cut(s) 51
BssMI GATC 2 cut(s) 105, 312
Bst2UI CCWGG 1 cut(s) 110
Bst4CI ACNGT 1 cut(s) 531
Bst6I CTCTTC 2 cut(s) 131, 520
BstC8I GCNNGC 1 cut(s) 86
BstDEI CTNAG 1 cut(s) 24
BstKTI GATC 2 cut(s) 108, 315
BstMAI GTCTC 2 cut(s) 369, 517
BstMBI GATC 2 cut(s) 105, 312
BstMWI GCNNNNNNNGC 2 cut(s) 236, 394
BstNI CCWGG 1 cut(s) 110
BstSCI CCNGG 2 cut(s) 50, 108
BstX2I RGATCY 1 cut(s) 105
BstYI RGATCY 1 cut(s) 105
Bsu15I ATCGAT 1 cut(s) 18
BsuRI GGCC 2 cut(s) 5, 56
BsuTUI ATCGAT 1 cut(s) 18
Cac8I GCNNGC 1 cut(s) 86
Cfr13I GGNCC 1 cut(s) 54
ClaI ATCGAT 1 cut(s) 18
Csp6I GTAC 1 cut(s) 539
CviJI RGCY 9 cut(s) 5, 56, 95, 152, 163, 169, 177, 268, 371
CviKI_1 RGCY 9 cut(s) 5, 56, 95, 152, 163, 169, 177, 268, 371
CviQI GTAC 1 cut(s) 539
DdeI CTNAG 1 cut(s) 24
DpnI GATC 2 cut(s) 107, 314
DpnII GATC 2 cut(s) 105, 312
DrdI GACNNNNNNGTC 1 cut(s) 278
DseDI GACNNNNNNGTC 1 cut(s) 278
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 2 cut(s) 131, 520
EarI CTCTTC 2 cut(s) 131, 520
EcoRII CCWGG 1 cut(s) 108
FaiI YATR 8 cut(s) 82, 275, 335, 348, 354, 356, 403, 441
FauNDI CATATG 1 cut(s) 354
FspBI CTAG 4 cut(s) 92, 203, 222, 392
GsuI CTGGAG 1 cut(s) 393
HaeIII GGCC 2 cut(s) 5, 56
HapII CCGG 1 cut(s) 51
HincII GTYRAC 2 cut(s) 283, 298
HindII GTYRAC 2 cut(s) 283, 298
HindIII AAGCTT 2 cut(s) 167, 266
HinfI GANTC 5 cut(s) 20, 251, 303, 444, 550
HpaI GTTAAC 1 cut(s) 298
HpaII CCGG 1 cut(s) 51
HphI GGTGA 2 cut(s) 40, 486
Hpy166II GTNNAC 3 cut(s) 283, 298, 494
Hpy188I TCNGA 4 cut(s) 308, 317, 426, 524
Hpy188III TCNNGA 2 cut(s) 262, 392
Hpy8I GTNNAC 3 cut(s) 283, 298, 494
HpyCH4III ACNGT 1 cut(s) 531
HpyCH4V TGCA 7 cut(s) 84, 125, 218, 290, 326, 413, 481
HpyF10VI GCNNNNNNNGC 2 cut(s) 236, 394
HpyF3I CTNAG 1 cut(s) 24
KspAI GTTAAC 1 cut(s) 298
Kzo9I GATC 2 cut(s) 105, 312
LguI GCTCTTC 1 cut(s) 131
LweI GCATC 3 cut(s) 24, 205, 397
MaeI CTAG 4 cut(s) 92, 203, 222, 392
MaeIII GTNAC 2 cut(s) 46, 208
MalI GATC 2 cut(s) 107, 314
MbiI CCGCTC 1 cut(s) 141
MboI GATC 2 cut(s) 105, 312
MboII GAAGA 2 cut(s) 148, 507
MflI RGATCY 1 cut(s) 105
MluCI AATT 3 cut(s) 36, 189, 562
MnlI CCTC 2 cut(s) 311, 518
MseI TTAA 5 cut(s) 119, 297, 533, 561, 565
MspI CCGG 1 cut(s) 51
MspR9I CCNGG 2 cut(s) 52, 110
Mva1269I GAATGC 1 cut(s) 328
MvaI CCWGG 1 cut(s) 110
MwoI GCNNNNNNNGC 2 cut(s) 236, 394
NciI CCSGG 1 cut(s) 52
NdeI CATATG 1 cut(s) 354
NdeII GATC 2 cut(s) 105, 312
NlaIV GGNNCC 2 cut(s) 55, 107
NmuCI GTSAC 1 cut(s) 46
PacI TTAATTAA 1 cut(s) 565
PciSI GCTCTTC 1 cut(s) 131
PctI GAATGC 1 cut(s) 328
PfeI GAWTC 5 cut(s) 20, 251, 303, 444, 550
Psp6I CCWGG 1 cut(s) 108
PspGI CCWGG 1 cut(s) 108
PspN4I GGNNCC 2 cut(s) 55, 107
PspPI GGNCC 1 cut(s) 54
PsuI RGATCY 1 cut(s) 105
RsaI GTAC 1 cut(s) 540
RsaNI GTAC 1 cut(s) 539
SapI GCTCTTC 1 cut(s) 131
SaqAI TTAA 5 cut(s) 119, 297, 533, 561, 565
Sau3AI GATC 2 cut(s) 105, 312
Sau96I GGNCC 1 cut(s) 54
ScrFI CCNGG 2 cut(s) 52, 110
SetI ASST 8 cut(s) 97, 154, 165, 171, 270, 373, 499, 540
SfaNI GCATC 3 cut(s) 24, 205, 397
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
Sse9I AATT 3 cut(s) 36, 189, 562
SsiI CCGC 1 cut(s) 141
SspMI CTAG 4 cut(s) 92, 203, 222, 392
StyD4I CCNGG 2 cut(s) 50, 108
TaaI ACNGT 1 cut(s) 531
TaqI TCGA 4 cut(s) 18, 156, 249, 472
TasI AATT 3 cut(s) 36, 189, 562
TfiI GAWTC 5 cut(s) 20, 251, 303, 444, 550
Tru1I TTAA 5 cut(s) 119, 297, 533, 561, 565
Tru9I TTAA 5 cut(s) 119, 297, 533, 561, 565
TseFI GTSAC 1 cut(s) 46
Tsp45I GTSAC 1 cut(s) 46
TspDTI ATGAA 2 cut(s) 185, 235
TspGWI ACGGA 1 cut(s) 315
XapI RAATTY 1 cut(s) 36
XbaI TCTAGA 1 cut(s) 391
XspI CTAG 4 cut(s) 92, 203, 222, 392
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.