Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006153.1

Orthogroup ID

OG0023121

Physical Location & Seq

Genomic Coordinates Reverse (-)

180944 .. 181459

Gene Structure 516 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006153.1_g000053.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 516 bp

atgaacatgaaaacgaggttggacaacgccattggtaatatctttttatgggcttcggcacagctagatctaaatgatacagcaccagggagcagtgatcttaagttgtgtgacttggttaacttgctcaatgaatctatcaaagaatttaacagtgattacttggagactttgaagggtaaagagggatatggaggcatgtgtgatttactagatttcatggaagaggggagttctatagaacctgcaccagagttttattcattctcaagctggactagattttttgaccaagttgattttggatgggggaggccatcttgggttggagtctcggggagggttggaaatagaaattttacaacattcgttgaaacacaatgcgatggcggaattgaagcgtgggtaactctaaatgaaaaacaaatggctaggctagaacaagatccacagtttttagcatttgcatctccaaacccccgaatttcaatagcctcttcagttggtattgattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0006807 GO:0008150 GO:0008152 GO:0009820 GO:0016740 GO:0016746 GO:0016747 GO:0050636 GO:0071704 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko00940 ko00941 ko00945 ko01100 ko01110 map00940 map00941 map00945 map01100 map01110

Pfam Domains

Protein Families

Transferase

Protein Analysis

171

Amino Acids

19.06

Weight (kDa)

4.32

Isoelectric Point (pI)

34.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0023121)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_sc0006153.1_g000053
rosa_samantha	Rh2AG147300 Rh2BG152500 Rh2DG152700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	253
AciI	CCGC	1 cut(s)	390
AclWI	GGATC	1 cut(s)	440
AcsI	RAATTY	3 cut(s)	146, 355, 483
AcuI	CTGAAG	1 cut(s)	483
AflII	CTTAAG	1 cut(s)	101
AgsI	TTSAA	4 cut(s)	175, 374, 398, 489
AjnI	CCWGG	1 cut(s)	85
AjuI	GAANNNNNNNTTGG	1 cut(s)	34
AluBI	AGCT	2 cut(s)	64, 273
AluI	AGCT	2 cut(s)	64, 273
Alw26I	GTCTC	2 cut(s)	161, 337
AlwI	GGATC	1 cut(s)	440
Ama87I	CYCGRG	1 cut(s)	334
AoxI	GGCC	1 cut(s)	314
ApoI	RAATTY	3 cut(s)	146, 355, 483
AvaI	CYCGRG	1 cut(s)	334
BccI	CCATC	3 cut(s)	300, 325, 380
BciT130I	CCWGG	1 cut(s)	87
BcoDI	GTCTC	2 cut(s)	161, 337
BfaI	CTAG	5 cut(s)	65, 212, 279, 432, 437
BfmI	CTRYAG	1 cut(s)	237
BfrI	CTTAAG	1 cut(s)	101
BfuAI	ACCTGC	1 cut(s)	253
BglII	AGATCT	1 cut(s)	67
Bme1390I	CCNGG	1 cut(s)	87
BmeT110I	CYCGRG	1 cut(s)	334
BmrFI	CCNGG	1 cut(s)	87
BmsI	GCATC	1 cut(s)	476
BpuEI	CTTGAG	1 cut(s)	253
BsaJI	CCNNGG	1 cut(s)	86
BseBI	CCWGG	1 cut(s)	87
BseDI	CCNNGG	1 cut(s)	86
BseGI	GGATG	1 cut(s)	311
BsgI	GTGCAG	1 cut(s)	231
BshFI	GGCC	1 cut(s)	316
BsiHKCI	CYCGRG	1 cut(s)	334
BsmAI	GTCTC	2 cut(s)	161, 337
BsnI	GGCC	1 cut(s)	316
BsoBI	CYCGRG	1 cut(s)	334
Bsp143I	GATC	3 cut(s)	67, 97, 445
BspACI	CCGC	1 cut(s)	390
BspANI	GGCC	1 cut(s)	316
BspMI	ACCTGC	1 cut(s)	253
BspPI	GGATC	1 cut(s)	440
BspTI	CTTAAG	1 cut(s)	101
BssECI	CCNNGG	1 cut(s)	86
BssMI	GATC	3 cut(s)	67, 97, 445
Bst2UI	CCWGG	1 cut(s)	87
Bst4CI	ACNGT	2 cut(s)	155, 453
Bst6I	CTCTTC	2 cut(s)	219, 502
BstAFI	CTTAAG	1 cut(s)	101
BstF5I	GGATG	1 cut(s)	311
BstKTI	GATC	3 cut(s)	70, 100, 448
BstMAI	GTCTC	2 cut(s)	161, 337
BstMBI	GATC	3 cut(s)	67, 97, 445
BstNI	CCWGG	1 cut(s)	87
BstNSI	RCATGY	1 cut(s)	202
BstSCI	CCNGG	1 cut(s)	85
BstSFI	CTRYAG	1 cut(s)	237
BstX2I	RGATCY	2 cut(s)	67, 445
BstYI	RGATCY	2 cut(s)	67, 445
BsuRI	GGCC	1 cut(s)	316
BtgZI	GCGATG	1 cut(s)	399
BtsCI	GGATG	1 cut(s)	311
BtsI	GCAGTG	1 cut(s)	100
BtsIMutI	CAGTG	2 cut(s)	100, 160
BveI	ACCTGC	1 cut(s)	253
CviAII	CATG	3 cut(s)	7, 199, 220
CviJI	RGCY	7 cut(s)	53, 64, 273, 316, 431, 436, 494
CviKI_1	RGCY	7 cut(s)	53, 64, 273, 316, 431, 436, 494
DpnI	GATC	3 cut(s)	69, 99, 447
DpnII	GATC	3 cut(s)	67, 97, 445
Eam1104I	CTCTTC	2 cut(s)	219, 502
EarI	CTCTTC	2 cut(s)	219, 502
EciI	GGCGGA	1 cut(s)	405
Eco57I	CTGAAG	1 cut(s)	483
Eco88I	CYCGRG	1 cut(s)	334
EcoRII	CCWGG	1 cut(s)	85
FaeI	CATG	3 cut(s)	10, 202, 223
FaiI	YATR	6 cut(s)	8, 49, 192, 200, 221, 239
FatI	CATG	3 cut(s)	6, 198, 219
FokI	GGATG	1 cut(s)	318
FspBI	CTAG	5 cut(s)	65, 212, 279, 432, 437
HaeIII	GGCC	1 cut(s)	316
Hin1II	CATG	3 cut(s)	10, 202, 223
HincII	GTYRAC	1 cut(s)	121
HindII	GTYRAC	1 cut(s)	121
HinfI	GANTC	2 cut(s)	134, 330
HpaI	GTTAAC	1 cut(s)	121
Hpy166II	GTNNAC	1 cut(s)	121
Hpy8I	GTNNAC	1 cut(s)	121
HpyAV	CCTTC	1 cut(s)	169
HpyCH4III	ACNGT	2 cut(s)	155, 453
HpyCH4V	TGCA	2 cut(s)	248, 467
Hsp92II	CATG	3 cut(s)	10, 202, 223
KspAI	GTTAAC	1 cut(s)	121
Kzo9I	GATC	3 cut(s)	67, 97, 445
LmnI	GCTCC	1 cut(s)	90
LpnPI	CCDG	5 cut(s)	72, 99, 258, 259, 264
LweI	GCATC	1 cut(s)	476
MaeI	CTAG	5 cut(s)	65, 212, 279, 432, 437
MaeIII	GTNAC	2 cut(s)	110, 406
MalI	GATC	3 cut(s)	69, 99, 447
MboI	GATC	3 cut(s)	67, 97, 445
MboII	GAAGA	2 cut(s)	236, 489
MflI	RGATCY	2 cut(s)	67, 445
MluCI	AATT	4 cut(s)	146, 355, 393, 483
MlyI	GAGTC	1 cut(s)	339
MmeI	TCCRAC	2 cut(s)	307, 325
MnlI	CCTC	7 cut(s)	9, 178, 188, 220, 306, 333, 505
MseI	TTAA	4 cut(s)	102, 120, 150, 514
MspCI	CTTAAG	1 cut(s)	101
MspR9I	CCNGG	1 cut(s)	87
MvaI	CCWGG	1 cut(s)	87
NdeII	GATC	3 cut(s)	67, 97, 445
NlaIII	CATG	3 cut(s)	10, 202, 223
NmuCI	GTSAC	1 cut(s)	110
NspI	RCATGY	1 cut(s)	202
PfeI	GAWTC	1 cut(s)	134
PleI	GAGTC	1 cut(s)	338
PpsI	GAGTC	1 cut(s)	338
Psp6I	CCWGG	1 cut(s)	85
PspGI	CCWGG	1 cut(s)	85
PsuI	RGATCY	2 cut(s)	67, 445
SaqAI	TTAA	4 cut(s)	102, 120, 150, 514
Sau3AI	GATC	3 cut(s)	67, 97, 445
SchI	GAGTC	1 cut(s)	339
ScrFI	CCNGG	1 cut(s)	87
SetI	ASST	4 cut(s)	20, 66, 247, 275
SfaNI	GCATC	1 cut(s)	476
SfcI	CTRYAG	1 cut(s)	237
SmlI	CTYRAG	2 cut(s)	101, 268
SmoI	CTYRAG	2 cut(s)	101, 268
Sse9I	AATT	4 cut(s)	146, 355, 393, 483
SsiI	CCGC	1 cut(s)	390
SspMI	CTAG	5 cut(s)	65, 212, 279, 432, 437
StyD4I	CCNGG	1 cut(s)	85
TaaI	ACNGT	2 cut(s)	155, 453
TasI	AATT	4 cut(s)	146, 355, 393, 483
TfiI	GAWTC	1 cut(s)	134
Tru1I	TTAA	4 cut(s)	102, 120, 150, 514
Tru9I	TTAA	4 cut(s)	102, 120, 150, 514
TscAI	CASTG	2 cut(s)	100, 160
TseFI	GTSAC	1 cut(s)	110
Tsp45I	GTSAC	1 cut(s)	110
TspDTI	ATGAA	6 cut(s)	17, 23, 147, 208, 252, 432
TspRI	CASTG	2 cut(s)	100, 160
Vha464I	CTTAAG	1 cut(s)	101
XapI	RAATTY	3 cut(s)	146, 355, 483
XceI	RCATGY	1 cut(s)	202
XcmI	CCANNNNNNNNNTGG	1 cut(s)	299
XspI	CTAG	5 cut(s)	65, 212, 279, 432, 437

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.