Rmu_sc0006543.1_g000006

UPF0481 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006543.1
OG0020573
Physical Location & Seq
Forward (+)
30290 .. 31028
739 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006543.1_g000006.1.cds

Sequence Viewer

Length: 621 bp
atgttgatgcttgaaaatcagatcccattcttcattctcgagtattttcattctgtatacttcaccaaccgtcctatttcttggctttccctctttgagcttacccataagttcttgcagaatagggtatacataaggtctcttggagatacgatgaagaaactcaatcatggtcctcaagaagaaagaatacaccattttgttgattttgttctaaaatgtcatcgacctcaaccttctgagcttcctcaaaaaaagaaactcaagactttaaccataccacgggccacagcattacaccaggctggagtcaagtttgtgaattgtgagcttcatgatcactacatcagcgattatgtgtttttcatagatcgcctggtggatcaatccaaggatgtggagctgcttgttgagaataatatccttgaatctaaactactagatagtgaaccagctgcggcctttattaactcacttgacttcgggtctattttgttcagtagagatttctactttactgatctctgtgaggctctgaatgcatactacagtgtcccctggcacaagtggaaggcaagcttgaaacaggactacttcagtactccatgtgtgttattgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF247

Protein Analysis

206

Amino Acids

24.31

Weight (kDa)

6.54

Isoelectric Point (pI)

41.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020573)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0298351 RchiOBHm_Chr6g0298371
rosa_multiflora Rmu_sc0006543.1_g000005 Rmu_sc0006543.1_g000006 Rmu_sc0010802.1_g000001
rosa_samantha Rh6AG391300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 57, 129
AciI CCGC 1 cut(s) 458
AclWI GGATC 2 cut(s) 16, 390
AcuI CTGAAG 1 cut(s) 580
AfaI GTAC 1 cut(s) 601
AfiI CCNNNNNNNGG 1 cut(s) 282
AgsI TTSAA 3 cut(s) 14, 428, 583
AhdI GACNNNNNGTC 1 cut(s) 484
AjnI CCWGG 3 cut(s) 300, 375, 557
AluBI AGCT 6 cut(s) 100, 244, 331, 403, 455, 579
AluI AGCT 6 cut(s) 100, 244, 331, 403, 455, 579
Alw26I GTCTC 1 cut(s) 144
AlwI GGATC 2 cut(s) 16, 390
Ama87I CYCGRG 1 cut(s) 38
AoxI GGCC 2 cut(s) 285, 459
ApeKI GCWGC 2 cut(s) 403, 455
AspS9I GGNCC 2 cut(s) 173, 285
AsuHPI GGTGA 1 cut(s) 55
AvaI CYCGRG 1 cut(s) 38
AvaII GGWCC 1 cut(s) 173
BarI GAAGNNNNNNTAC 2 cut(s) 174, 206
BbvI GCAGC 2 cut(s) 390, 442
BciT130I CCWGG 3 cut(s) 302, 377, 559
BclI TGATCA 1 cut(s) 337
BcoDI GTCTC 1 cut(s) 144
BfaI CTAG 1 cut(s) 440
BfmI CTRYAG 1 cut(s) 547
BisI GCNGC 3 cut(s) 404, 456, 459
BlsI GCNGC 3 cut(s) 405, 457, 460
BmcAI AGTACT 1 cut(s) 601
Bme1390I CCNGG 3 cut(s) 302, 377, 559
Bme18I GGWCC 1 cut(s) 173
BmeRI GACNNNNNGTC 1 cut(s) 484
BmeT110I CYCGRG 1 cut(s) 38
BmgT120I GGNCC 2 cut(s) 173, 285
BmrFI CCNGG 3 cut(s) 302, 377, 559
BpmI CTGGAG 1 cut(s) 327
BpuEI CTTGAG 2 cut(s) 162, 248
BsaI GGTCTC 1 cut(s) 144
BsaJI CCNNGG 3 cut(s) 281, 390, 557
Bsc4I CCNNNNNNNGG 1 cut(s) 282
BseBI CCWGG 3 cut(s) 302, 377, 559
BseDI CCNNGG 3 cut(s) 281, 390, 557
BseGI GGATG 1 cut(s) 400
BseLI CCNNNNNNNGG 1 cut(s) 282
BseMII CTCAG 1 cut(s) 231
BseXI GCAGC 2 cut(s) 390, 442
BshFI GGCC 2 cut(s) 287, 461
BsiHKCI CYCGRG 1 cut(s) 38
BslFI GGGAC 1 cut(s) 539
BslI CCNNNNNNNGG 1 cut(s) 282
BsmAI GTCTC 1 cut(s) 144
BsmFI GGGAC 1 cut(s) 539
BsmI GAATGC 1 cut(s) 544
BsnI GGCC 2 cut(s) 287, 461
Bso31I GGTCTC 1 cut(s) 144
BsoBI CYCGRG 1 cut(s) 38
Bsp143I GATC 5 cut(s) 21, 337, 370, 382, 520
BspACI CCGC 1 cut(s) 458
BspANI GGCC 2 cut(s) 287, 461
BspCNI CTCAG 1 cut(s) 232
BspHI TCATGA 1 cut(s) 334
BspPI GGATC 2 cut(s) 16, 390
BspTNI GGTCTC 1 cut(s) 144
BssECI CCNNGG 3 cut(s) 281, 390, 557
BssMI GATC 5 cut(s) 21, 337, 370, 382, 520
BssNAI GTATAC 2 cut(s) 58, 130
BssT1I CCWWGG 1 cut(s) 390
Bst1107I GTATAC 2 cut(s) 58, 130
Bst2UI CCWGG 3 cut(s) 302, 377, 559
Bst4CI ACNGT 2 cut(s) 71, 551
BstC8I GCNNGC 1 cut(s) 577
BstDEI CTNAG 1 cut(s) 240
BstDSI CCRYGG 1 cut(s) 281
BstF5I GGATG 1 cut(s) 400
BstKTI GATC 5 cut(s) 24, 340, 373, 385, 523
BstMAI GTCTC 1 cut(s) 144
BstMBI GATC 5 cut(s) 21, 337, 370, 382, 520
BstMWI GCNNNNNNNGC 1 cut(s) 539
BstNI CCWGG 3 cut(s) 302, 377, 559
BstSCI CCNGG 3 cut(s) 300, 375, 557
BstSFI CTRYAG 1 cut(s) 547
BstV1I GCAGC 2 cut(s) 390, 442
BstX2I RGATCY 1 cut(s) 21
BstXI CCANNNNNNTGG 1 cut(s) 397
BstYI RGATCY 1 cut(s) 21
BstZ17I GTATAC 2 cut(s) 58, 130
BsuRI GGCC 2 cut(s) 287, 461
BtgI CCRYGG 1 cut(s) 281
BtsCI GGATG 1 cut(s) 400
BtsIMutI CAGTG 1 cut(s) 556
Cac8I GCNNGC 1 cut(s) 577
CciI TCATGA 1 cut(s) 334
Cfr13I GGNCC 2 cut(s) 173, 285
Csp6I GTAC 1 cut(s) 600
CviAII CATG 3 cut(s) 170, 335, 606
CviQI GTAC 1 cut(s) 600
DdeI CTNAG 1 cut(s) 240
DpnI GATC 5 cut(s) 23, 339, 372, 384, 522
DpnII GATC 5 cut(s) 21, 337, 370, 382, 520
DriI GACNNNNNGTC 1 cut(s) 484
Eam1105I GACNNNNNGTC 1 cut(s) 484
Eco130I CCWWGG 1 cut(s) 390
Eco31I GGTCTC 1 cut(s) 144
Eco47I GGWCC 1 cut(s) 173
Eco57I CTGAAG 1 cut(s) 580
Eco88I CYCGRG 1 cut(s) 38
EcoRII CCWGG 3 cut(s) 300, 375, 557
EcoT14I CCWWGG 1 cut(s) 390
EcoT22I ATGCAT 1 cut(s) 544
ErhI CCWWGG 1 cut(s) 390
FaeI CATG 3 cut(s) 173, 338, 609
FalI AAGNNNNNCTT 2 cut(s) 563, 595
FaqI GGGAC 1 cut(s) 539
FatI CATG 3 cut(s) 169, 334, 605
FbaI TGATCA 1 cut(s) 337
FblI GTMKAC 2 cut(s) 57, 129
Fnu4HI GCNGC 3 cut(s) 404, 456, 459
FokI GGATG 1 cut(s) 407
Fsp4HI GCNGC 3 cut(s) 404, 456, 459
FspBI CTAG 1 cut(s) 440
GluI GCNGC 3 cut(s) 404, 456, 459
GsuI CTGGAG 1 cut(s) 327
HaeIII GGCC 2 cut(s) 287, 461
Hin1II CATG 3 cut(s) 173, 338, 609
HindIII AAGCTT 1 cut(s) 577
HinfI GANTC 2 cut(s) 309, 428
HphI GGTGA 1 cut(s) 55
Hpy166II GTNNAC 3 cut(s) 58, 130, 449
Hpy188I TCNGA 3 cut(s) 21, 241, 537
Hpy188III TCNNGA 4 cut(s) 38, 179, 265, 335
Hpy8I GTNNAC 3 cut(s) 58, 130, 449
HpyAV CCTTC 2 cut(s) 246, 565
HpyCH4III ACNGT 2 cut(s) 71, 551
HpyCH4V TGCA 2 cut(s) 118, 542
HpyF10VI GCNNNNNNNGC 1 cut(s) 539
HpyF3I CTNAG 1 cut(s) 240
Hsp92II CATG 3 cut(s) 173, 338, 609
Ksp22I TGATCA 1 cut(s) 337
Kzo9I GATC 5 cut(s) 21, 337, 370, 382, 520
LmnI GCTCC 1 cut(s) 400
LpnPI CCDG 9 cut(s) 287, 291, 314, 362, 389, 465, 544, 571, 572
Lsp1109I GCAGC 2 cut(s) 390, 442
MaeI CTAG 1 cut(s) 440
MalI GATC 5 cut(s) 23, 339, 372, 384, 522
MboI GATC 5 cut(s) 21, 337, 370, 382, 520
MboII GAAGA 3 cut(s) 22, 169, 194
MflI RGATCY 1 cut(s) 21
MluCI AATT 1 cut(s) 322
MlyI GAGTC 1 cut(s) 318
MnlI CCTC 5 cut(s) 101, 186, 240, 258, 523
Mph1103I ATGCAT 1 cut(s) 544
MseI TTAA 2 cut(s) 272, 468
MspA1I CMGCKG 1 cut(s) 455
MspR9I CCNGG 3 cut(s) 302, 377, 559
Mva1269I GAATGC 1 cut(s) 544
MvaI CCWGG 3 cut(s) 302, 377, 559
MwoI GCNNNNNNNGC 1 cut(s) 539
NdeII GATC 5 cut(s) 21, 337, 370, 382, 520
NlaIII CATG 3 cut(s) 173, 338, 609
NsiI ATGCAT 1 cut(s) 544
PaeR7I CTCGAG 1 cut(s) 38
PagI TCATGA 1 cut(s) 334
PctI GAATGC 1 cut(s) 544
PfeI GAWTC 1 cut(s) 428
PkrI GCNGC 3 cut(s) 405, 457, 460
PleI GAGTC 1 cut(s) 317
PpsI GAGTC 1 cut(s) 317
Psp6I CCWGG 3 cut(s) 300, 375, 557
PspGI CCWGG 3 cut(s) 300, 375, 557
PspPI GGNCC 2 cut(s) 173, 285
PsuI RGATCY 1 cut(s) 21
PvuII CAGCTG 1 cut(s) 455
RsaI GTAC 1 cut(s) 601
RsaNI GTAC 1 cut(s) 600
SaqAI TTAA 2 cut(s) 272, 468
SatI GCNGC 3 cut(s) 404, 456, 459
Sau3AI GATC 5 cut(s) 21, 337, 370, 382, 520
Sau96I GGNCC 2 cut(s) 173, 285
ScaI AGTACT 1 cut(s) 601
SchI GAGTC 1 cut(s) 318
ScrFI CCNGG 3 cut(s) 302, 377, 559
SetI ASST 9 cut(s) 102, 140, 232, 238, 246, 333, 405, 457, 581
SfcI CTRYAG 1 cut(s) 547
Sfr274I CTCGAG 1 cut(s) 38
SinI GGWCC 1 cut(s) 173
SlaI CTCGAG 1 cut(s) 38
SmlI CTYRAG 3 cut(s) 38, 177, 263
SmoI CTYRAG 3 cut(s) 38, 177, 263
Sse9I AATT 1 cut(s) 322
SsiI CCGC 1 cut(s) 458
SspMI CTAG 1 cut(s) 440
StyD4I CCNGG 3 cut(s) 300, 375, 557
StyI CCWWGG 1 cut(s) 390
TaaI ACNGT 2 cut(s) 71, 551
TaqI TCGA 2 cut(s) 39, 226
TasI AATT 1 cut(s) 322
TatI WGTACW 1 cut(s) 599
TauI GCSGC 1 cut(s) 461
TfiI GAWTC 1 cut(s) 428
Tru1I TTAA 2 cut(s) 272, 468
Tru9I TTAA 2 cut(s) 272, 468
TscAI CASTG 1 cut(s) 556
TseI GCWGC 2 cut(s) 403, 455
TspDTI ATGAA 5 cut(s) 22, 38, 170, 323, 355
TspRI CASTG 1 cut(s) 556
VpaK11BI GGWCC 1 cut(s) 173
XhoI CTCGAG 1 cut(s) 38
XmiI GTMKAC 2 cut(s) 57, 129
XspI CTAG 1 cut(s) 440
ZrmI AGTACT 1 cut(s) 601
Zsp2I ATGCAT 1 cut(s) 544
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.