Rmu_sc0007698.1_g000007

Replication factor C subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007698.1
OG0025519
Physical Location & Seq
Forward (+)
28200 .. 29264
1065 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007698.1_g000007.1.cds

Sequence Viewer

Length: 891 bp
atgaatgccaatgcaaagcttgctagaactcctccaaaggctaattctccactagcttttggaagttcagagtctattgcaccaggtgatatcttcttctctcgtgactgcaaaatcttggcactgcccaaaactgtcaatcccgtaccaaaaccaaagaatggtattggttttgagaaccgcttaattacttctaatgtcaaaattgctacccaaagaggaaatggtttcgatcagaatgctcgagggactccattaagctacaatttgtcacaggcaaccacaacaacatcaagctcagcattgagcaggcaaagcagtaagatgagtggtacaagtggtagcacaactgcgagtgccaagaaattcacagcaagcagaaagaaaagcgaaagtcactcactgtatgcttgtatgagaaagggagagtcttgtcggaaaacaaaatcacctgagcattctcctgttttcaatgaagcttcccttatacagaaagcgcttgtggtttttcgtctacggcagttttgggctaataagcatcgactggcttcgttgaatggattcacttcccacaagcaagaaactcaacttctcgaggatctggtcgttgacaataaatttctctcaagcatcgacattttgtctactggaccatctggttctgggaaaaaagctctaaaaatggctttcctaagagagagatacggtgatgcaagctgggaagtacctcatgatttaagatacttccagattcaggtattctgtactcgaagagatattcaggtatacttccatcaggtattcaaactttgcaactttgaaatattagttaagccttggattttgcaagttgttcctaggaacttacgttatcaatctagtgaacactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03030 ko03420 ko03430 map03030 map03420 map03430
Pfam Domains
Protein Families
DNA_pol3_delta2 NmrA

Protein Analysis

296

Amino Acids

33.04

Weight (kDa)

10.07

Isoelectric Point (pI)

46.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025519)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0001862.1_g000010 Rmu_sc0007698.1_g000007
rosa_wichuraiana Rw2G011280

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 161
AccI GTMKAC 3 cut(s) 514, 644, 786
AciI CCGC 1 cut(s) 181
AclWI GGATC 1 cut(s) 606
AcsI RAATTY 2 cut(s) 365, 617
AdeI CACNNNGTG 1 cut(s) 86
AfaI GTAC 4 cut(s) 147, 334, 726, 766
AfeI AGCGCT 1 cut(s) 498
AfiI CCNNNNNNNGG 2 cut(s) 161, 754
AgsI TTSAA 4 cut(s) 472, 556, 805, 821
AhdI GACNNNNNGTC 1 cut(s) 640
AjnI CCWGG 1 cut(s) 82
AjuI GAANNNNNNNTTGG 2 cut(s) 28, 60
AluBI AGCT 7 cut(s) 19, 56, 261, 297, 479, 674, 717
AluI AGCT 7 cut(s) 19, 56, 261, 297, 479, 674, 717
AlwI GGATC 1 cut(s) 606
Ama87I CYCGRG 2 cut(s) 243, 593
Aor51HI AGCGCT 1 cut(s) 498
ApoI RAATTY 2 cut(s) 365, 617
Asp700I GAANNNNTTC 1 cut(s) 560
AspA2I CCTAGG 1 cut(s) 857
AspLEI GCGC 1 cut(s) 499
AspS9I GGNCC 1 cut(s) 650
AsuHPI GGTGA 3 cut(s) 98, 441, 719
AvaI CYCGRG 2 cut(s) 243, 593
AvaII GGWCC 1 cut(s) 650
AvrII CCTAGG 1 cut(s) 857
BauI CACGAG 1 cut(s) 102
BccI CCATC 2 cut(s) 661, 801
BceAI ACGGC 1 cut(s) 533
BcgI CGANNNNNNTGC 2 cut(s) 221, 255
BciT130I CCWGG 1 cut(s) 84
BfaI CTAG 4 cut(s) 24, 53, 858, 879
BfoI RGCGCY 1 cut(s) 500
BlnI CCTAGG 1 cut(s) 857
BlpI GCTNAGC 1 cut(s) 298
Bme1390I CCNGG 1 cut(s) 84
Bme18I GGWCC 1 cut(s) 650
BmeRI GACNNNNNGTC 1 cut(s) 640
BmeT110I CYCGRG 2 cut(s) 243, 593
BmgT120I GGNCC 1 cut(s) 650
BmrFI CCNGG 1 cut(s) 84
BmsI GCATC 3 cut(s) 547, 639, 700
Bpu10I CCTNAGC 1 cut(s) 453
Bpu1102I GCTNAGC 1 cut(s) 298
BpuEI CTTGAG 1 cut(s) 610
BsaJI CCNNGG 2 cut(s) 836, 857
Bsc4I CCNNNNNNNGG 2 cut(s) 161, 754
Bse1I ACTGG 2 cut(s) 549, 652
BseBI CCWGG 1 cut(s) 84
BseDI CCNNGG 2 cut(s) 836, 857
BseLI CCNNNNNNNGG 2 cut(s) 161, 754
BseMII CTCAG 2 cut(s) 312, 444
BseNI ACTGG 2 cut(s) 549, 652
BseRI GAGGAG 1 cut(s) 21
BseYI CCCAGC 1 cut(s) 717
BsiHKCI CYCGRG 2 cut(s) 243, 593
BslFI GGGAC 1 cut(s) 262
BslI CCNNNNNNNGG 2 cut(s) 161, 754
BsmFI GGGAC 1 cut(s) 262
BsmI GAATGC 3 cut(s) 10, 244, 457
BsoBI CYCGRG 2 cut(s) 243, 593
Bsp143I GATC 2 cut(s) 232, 598
Bsp1720I GCTNAGC 1 cut(s) 298
BspACI CCGC 1 cut(s) 181
BspCNI CTCAG 2 cut(s) 311, 445
BspHI TCATGA 1 cut(s) 730
BspPI GGATC 1 cut(s) 606
BsrI ACTGG 2 cut(s) 549, 652
BssECI CCNNGG 2 cut(s) 836, 857
BssMI GATC 2 cut(s) 232, 598
BssNAI GTATAC 1 cut(s) 787
BssSI CACGAG 1 cut(s) 102
BssT1I CCWWGG 2 cut(s) 836, 857
Bst1107I GTATAC 1 cut(s) 787
Bst2BI CACGAG 1 cut(s) 102
Bst2UI CCWGG 1 cut(s) 84
Bst4CI ACNGT 3 cut(s) 136, 405, 707
Bst6I CTCTTC 1 cut(s) 766
BstAPI GCANNNNNTGC 1 cut(s) 20
BstC8I GCNNGC 4 cut(s) 21, 311, 376, 715
BstDEI CTNAG 3 cut(s) 298, 453, 692
BstH2I RGCGCY 1 cut(s) 500
BstHHI GCGC 1 cut(s) 499
BstKTI GATC 2 cut(s) 235, 601
BstMBI GATC 2 cut(s) 232, 598
BstMWI GCNNNNNNNGC 2 cut(s) 20, 315
BstNI CCWGG 1 cut(s) 84
BstSCI CCNGG 1 cut(s) 82
BstX2I RGATCY 1 cut(s) 598
BstYI RGATCY 1 cut(s) 598
BstZ17I GTATAC 1 cut(s) 787
BtsI GCAGTG 1 cut(s) 122
BtsIMutI CAGTG 2 cut(s) 122, 401
Cac8I GCNNGC 4 cut(s) 21, 311, 376, 715
CciI TCATGA 1 cut(s) 730
CfoI GCGC 1 cut(s) 499
Cfr13I GGNCC 1 cut(s) 650
CsiI ACCWGGT 1 cut(s) 82
Csp6I GTAC 4 cut(s) 146, 333, 725, 765
CviAII CATG 1 cut(s) 731
CviQI GTAC 4 cut(s) 146, 333, 725, 765
DdeI CTNAG 3 cut(s) 298, 453, 692
DpnI GATC 2 cut(s) 234, 600
DpnII GATC 2 cut(s) 232, 598
DraIII CACNNNGTG 1 cut(s) 86
DriI GACNNNNNGTC 1 cut(s) 640
Eam1104I CTCTTC 1 cut(s) 766
Eam1105I GACNNNNNGTC 1 cut(s) 640
EarI CTCTTC 1 cut(s) 766
Eco130I CCWWGG 2 cut(s) 836, 857
Eco32I GATATC 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 650
Eco47III AGCGCT 1 cut(s) 498
Eco88I CYCGRG 2 cut(s) 243, 593
EcoRII CCWGG 1 cut(s) 82
EcoRV GATATC 1 cut(s) 91
EcoT14I CCWWGG 2 cut(s) 836, 857
ErhI CCWWGG 2 cut(s) 836, 857
FaeI CATG 1 cut(s) 734
FaiI YATR 5 cut(s) 408, 416, 488, 732, 787
FalI AAGNNNNNCTT 2 cut(s) 468, 500
FaqI GGGAC 1 cut(s) 262
FatI CATG 1 cut(s) 730
FblI GTMKAC 3 cut(s) 514, 644, 786
FspBI CTAG 4 cut(s) 24, 53, 858, 879
GlaI GCGC 1 cut(s) 498
GsaI CCCAGC 1 cut(s) 721
HaeII RGCGCY 1 cut(s) 500
HhaI GCGC 1 cut(s) 499
Hin1II CATG 1 cut(s) 734
Hin6I GCGC 1 cut(s) 497
HinP1I GCGC 1 cut(s) 497
HincII GTYRAC 1 cut(s) 610
HindII GTYRAC 1 cut(s) 610
HindIII AAGCTT 2 cut(s) 17, 477
HinfI GANTC 5 cut(s) 71, 250, 428, 561, 751
HphI GGTGA 3 cut(s) 98, 441, 719
Hpy166II GTNNAC 5 cut(s) 515, 610, 645, 787, 884
Hpy188I TCNGA 3 cut(s) 70, 237, 438
Hpy188III TCNNGA 4 cut(s) 104, 593, 731, 748
Hpy8I GTNNAC 5 cut(s) 515, 610, 645, 787, 884
HpyCH4III ACNGT 3 cut(s) 136, 405, 707
HpyCH4IV ACGT 1 cut(s) 868
HpyCH4V TGCA 6 cut(s) 14, 80, 111, 713, 813, 847
HpyF10VI GCNNNNNNNGC 2 cut(s) 20, 315
HpyF3I CTNAG 3 cut(s) 298, 453, 692
HpySE526I ACGT 1 cut(s) 868
Hsp92II CATG 1 cut(s) 734
HspAI GCGC 1 cut(s) 497
Kzo9I GATC 2 cut(s) 232, 598
LweI GCATC 3 cut(s) 547, 639, 700
MabI ACCWGGT 1 cut(s) 82
MaeI CTAG 4 cut(s) 24, 53, 858, 879
MaeII ACGT 1 cut(s) 868
MaeIII GTNAC 3 cut(s) 104, 270, 395
MalI GATC 2 cut(s) 234, 600
MboI GATC 2 cut(s) 232, 598
MboII GAAGA 3 cut(s) 85, 88, 783
MflI RGATCY 1 cut(s) 598
MluCI AATT 6 cut(s) 43, 186, 204, 265, 365, 617
MlyI GAGTC 3 cut(s) 80, 244, 437
MmeI TCCRAC 1 cut(s) 416
MnlI CCTC 5 cut(s) 42, 212, 239, 589, 738
MroXI GAANNNNTTC 1 cut(s) 560
MseI TTAA 4 cut(s) 185, 257, 737, 831
MspR9I CCNGG 1 cut(s) 84
Mva1269I GAATGC 3 cut(s) 10, 244, 457
MvaI CCWGG 1 cut(s) 84
MwoI GCNNNNNNNGC 2 cut(s) 20, 315
NdeII GATC 2 cut(s) 232, 598
NlaIII CATG 1 cut(s) 734
NmuCI GTSAC 3 cut(s) 104, 270, 395
PaeR7I CTCGAG 2 cut(s) 243, 593
PagI TCATGA 1 cut(s) 730
PctI GAATGC 3 cut(s) 10, 244, 457
PdmI GAANNNNTTC 1 cut(s) 560
PfeI GAWTC 2 cut(s) 561, 751
PflMI CCANNNNNTGG 1 cut(s) 161
PleI GAGTC 3 cut(s) 79, 244, 436
PpsI GAGTC 3 cut(s) 79, 244, 436
Psp6I CCWGG 1 cut(s) 82
PspFI CCCAGC 1 cut(s) 717
PspGI CCWGG 1 cut(s) 82
PspPI GGNCC 1 cut(s) 650
PspXI VCTCGAGB 1 cut(s) 243
PsuI RGATCY 1 cut(s) 598
RsaI GTAC 4 cut(s) 147, 334, 726, 766
RsaNI GTAC 4 cut(s) 146, 333, 725, 765
SaqAI TTAA 4 cut(s) 185, 257, 737, 831
Sau3AI GATC 2 cut(s) 232, 598
Sau96I GGNCC 1 cut(s) 650
SchI GAGTC 3 cut(s) 80, 244, 437
ScrFI CCNGG 1 cut(s) 84
SexAI ACCWGGT 1 cut(s) 82
SfaNI GCATC 3 cut(s) 547, 639, 700
Sfr274I CTCGAG 2 cut(s) 243, 593
SinI GGWCC 1 cut(s) 650
SlaI CTCGAG 2 cut(s) 243, 593
SmlI CTYRAG 3 cut(s) 243, 593, 625
SmoI CTYRAG 3 cut(s) 243, 593, 625
Sse9I AATT 6 cut(s) 43, 186, 204, 265, 365, 617
SsiI CCGC 1 cut(s) 181
SspI AATATT 1 cut(s) 825
SspMI CTAG 4 cut(s) 24, 53, 858, 879
StyD4I CCNGG 1 cut(s) 82
StyI CCWWGG 2 cut(s) 836, 857
TaaI ACNGT 3 cut(s) 136, 405, 707
TaiI ACGT 1 cut(s) 871
TaqI TCGA 6 cut(s) 231, 244, 541, 594, 633, 769
TasI AATT 6 cut(s) 43, 186, 204, 265, 365, 617
TatI WGTACW 1 cut(s) 764
TfiI GAWTC 2 cut(s) 561, 751
Tru1I TTAA 4 cut(s) 185, 257, 737, 831
Tru9I TTAA 4 cut(s) 185, 257, 737, 831
TscAI CASTG 2 cut(s) 129, 408
TseFI GTSAC 3 cut(s) 104, 270, 395
Tsp45I GTSAC 3 cut(s) 104, 270, 395
TspDTI ATGAA 2 cut(s) 17, 489
TspRI CASTG 2 cut(s) 129, 408
Van91I CCANNNNNTGG 1 cut(s) 161
VpaK11BI GGWCC 1 cut(s) 650
XapI RAATTY 2 cut(s) 365, 617
XcmI CCANNNNNNNNNTGG 1 cut(s) 221
XhoI CTCGAG 2 cut(s) 243, 593
XmaJI CCTAGG 1 cut(s) 857
XmiI GTMKAC 3 cut(s) 514, 644, 786
XmnI GAANNNNTTC 1 cut(s) 560
XspI CTAG 4 cut(s) 24, 53, 858, 879
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.