Rmu_sc0008372.1_g000002

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008372.1
OG0020064
Physical Location & Seq
Reverse (-)
2496 .. 2918
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008372.1_g000002.1.cds

Sequence Viewer

Length: 423 bp
atggagacatgtccaagcttccaagatcaaggatactatgatcaaaataccatggttgaaggatttcatgacaaccaagggcattggaataattattattcacctcgatacaatccggcatgggataatcctccttactcttcgtggaatgatgatccaaacgtgcaacaaggatctttcaatgagttcgaagattcttcatattcataccatgactattggccacaagccccacctcctcaaaactcaggtacgtctaataatgatgatgagattattaaggaactaaatactgctactcaagctttgattcagggacaacaagctttagatacttcttttcaagcttggattcaggaaaagcaagctcttgatgatgatttggcagaaaaattaaagcatttggagaacttaatatcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

140

Amino Acids

16.23

Weight (kDa)

4.05

Isoelectric Point (pI)

36.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 149, 181
AcoI YGGCCR 1 cut(s) 221
AfaI GTAC 1 cut(s) 253
AflIII ACRYGT 1 cut(s) 8
AgsI TTSAA 3 cut(s) 59, 181, 344
AluBI AGCT 5 cut(s) 18, 305, 326, 347, 368
AluI AGCT 5 cut(s) 18, 305, 326, 347, 368
AlwI GGATC 2 cut(s) 149, 181
AoxI GGCC 1 cut(s) 221
Asp700I GAANNNNTTC 1 cut(s) 63
AsuHPI GGTGA 1 cut(s) 93
AsuII TTCGAA 1 cut(s) 189
BalI TGGCCA 1 cut(s) 223
BciVI GTATCC 1 cut(s) 26
BclI TGATCA 1 cut(s) 40
BfuI GTATCC 1 cut(s) 26
Bpu14I TTCGAA 1 cut(s) 189
BpuEI CTTGAG 1 cut(s) 285
BsaJI CCNNGG 2 cut(s) 51, 76
BseDI CCNNGG 2 cut(s) 51, 76
BseMII CTCAG 1 cut(s) 261
BseRI GAGGAG 1 cut(s) 228
BshFI GGCC 1 cut(s) 223
BsiSI CCGG 1 cut(s) 116
BslFI GGGAC 1 cut(s) 330
BsmFI GGGAC 1 cut(s) 330
BsnI GGCC 1 cut(s) 223
Bsp119I TTCGAA 1 cut(s) 189
Bsp143I GATC 4 cut(s) 25, 40, 154, 173
Bsp19I CCATGG 1 cut(s) 51
BspANI GGCC 1 cut(s) 223
BspCNI CTCAG 1 cut(s) 260
BspHI TCATGA 1 cut(s) 67
BspPI GGATC 2 cut(s) 149, 181
BspT104I TTCGAA 1 cut(s) 189
BssECI CCNNGG 2 cut(s) 51, 76
BssMI GATC 4 cut(s) 25, 40, 154, 173
BssT1I CCWWGG 2 cut(s) 51, 76
Bst6I CTCTTC 1 cut(s) 145
BstBI TTCGAA 1 cut(s) 189
BstC8I GCNNGC 1 cut(s) 366
BstDEI CTNAG 2 cut(s) 247, 420
BstDSI CCRYGG 1 cut(s) 51
BstKTI GATC 4 cut(s) 28, 43, 157, 176
BstMBI GATC 4 cut(s) 25, 40, 154, 173
BstMWI GCNNNNNNNGC 1 cut(s) 302
BstNSI RCATGY 1 cut(s) 12
BstX2I RGATCY 1 cut(s) 173
BstYI RGATCY 1 cut(s) 173
BsuI GTATCC 1 cut(s) 26
BsuRI GGCC 1 cut(s) 223
BtgI CCRYGG 1 cut(s) 51
Cac8I GCNNGC 1 cut(s) 366
CciI TCATGA 1 cut(s) 67
Csp6I GTAC 1 cut(s) 252
CviAII CATG 5 cut(s) 9, 52, 68, 120, 212
CviJI RGCY 7 cut(s) 18, 223, 230, 305, 326, 347, 368
CviKI_1 RGCY 7 cut(s) 18, 223, 230, 305, 326, 347, 368
CviQI GTAC 1 cut(s) 252
DdeI CTNAG 2 cut(s) 247, 420
DpnI GATC 4 cut(s) 27, 42, 156, 175
DpnII GATC 4 cut(s) 25, 40, 154, 173
EaeI YGGCCR 1 cut(s) 221
Eam1104I CTCTTC 1 cut(s) 145
EarI CTCTTC 1 cut(s) 145
Eco130I CCWWGG 2 cut(s) 51, 76
EcoT14I CCWWGG 2 cut(s) 51, 76
ErhI CCWWGG 2 cut(s) 51, 76
FaeI CATG 5 cut(s) 12, 55, 71, 123, 215
FaiI YATR 8 cut(s) 10, 39, 53, 69, 121, 202, 208, 213
FaqI GGGAC 1 cut(s) 330
FatI CATG 5 cut(s) 8, 51, 67, 119, 211
FbaI TGATCA 1 cut(s) 40
HaeIII GGCC 1 cut(s) 223
HapII CCGG 1 cut(s) 116
Hin1II CATG 5 cut(s) 12, 55, 71, 123, 215
HindIII AAGCTT 4 cut(s) 16, 303, 324, 345
HinfI GANTC 3 cut(s) 194, 310, 352
HpaII CCGG 1 cut(s) 116
HphI GGTGA 1 cut(s) 93
Hpy188III TCNNGA 3 cut(s) 68, 356, 371
HpyAV CCTTC 1 cut(s) 53
HpyCH4IV ACGT 2 cut(s) 162, 254
HpyCH4V TGCA 1 cut(s) 166
HpyF10VI GCNNNNNNNGC 1 cut(s) 302
HpyF3I CTNAG 2 cut(s) 247, 420
HpySE526I ACGT 2 cut(s) 162, 254
Hsp92II CATG 5 cut(s) 12, 55, 71, 123, 215
Ksp22I TGATCA 1 cut(s) 40
Kzo9I GATC 4 cut(s) 25, 40, 154, 173
LpnPI CCDG 4 cut(s) 129, 234, 299, 341
MaeII ACGT 2 cut(s) 162, 254
MalI GATC 4 cut(s) 27, 42, 156, 175
MboI GATC 4 cut(s) 25, 40, 154, 173
MboII GAAGA 3 cut(s) 132, 189, 203
MflI RGATCY 1 cut(s) 173
MlsI TGGCCA 1 cut(s) 223
MluCI AATT 2 cut(s) 91, 392
MluNI TGGCCA 1 cut(s) 223
MnlI CCTC 4 cut(s) 114, 141, 246, 249
Mox20I TGGCCA 1 cut(s) 223
MroXI GAANNNNTTC 1 cut(s) 63
MscI TGGCCA 1 cut(s) 223
MseI TTAA 3 cut(s) 279, 395, 413
Msp20I TGGCCA 1 cut(s) 223
MspI CCGG 1 cut(s) 116
MwoI GCNNNNNNNGC 1 cut(s) 302
NcoI CCATGG 1 cut(s) 51
NdeII GATC 4 cut(s) 25, 40, 154, 173
NlaIII CATG 5 cut(s) 12, 55, 71, 123, 215
NspI RCATGY 1 cut(s) 12
NspV TTCGAA 1 cut(s) 189
PagI TCATGA 1 cut(s) 67
PciI ACATGT 1 cut(s) 8
PdmI GAANNNNTTC 1 cut(s) 63
PfeI GAWTC 3 cut(s) 194, 310, 352
PscI ACATGT 1 cut(s) 8
PsuI RGATCY 1 cut(s) 173
RsaI GTAC 1 cut(s) 253
RsaNI GTAC 1 cut(s) 252
SaqAI TTAA 3 cut(s) 279, 395, 413
Sau3AI GATC 4 cut(s) 25, 40, 154, 173
SfuI TTCGAA 1 cut(s) 189
SmlI CTYRAG 1 cut(s) 300
SmoI CTYRAG 1 cut(s) 300
Sse9I AATT 2 cut(s) 91, 392
StyI CCWWGG 2 cut(s) 51, 76
TaiI ACGT 2 cut(s) 165, 257
TaqI TCGA 2 cut(s) 106, 189
TasI AATT 2 cut(s) 91, 392
TfiI GAWTC 3 cut(s) 194, 310, 352
Tru1I TTAA 3 cut(s) 279, 395, 413
Tru9I TTAA 3 cut(s) 279, 395, 413
TspDTI ATGAA 3 cut(s) 56, 189, 195
XceI RCATGY 1 cut(s) 12
XmnI GAANNNNTTC 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.