Rmu_sc0010284.1_g000005

Conserved oligomeric Golgi complex subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0010284.1
Physical Location & Seq
Forward (+)
19952 .. 21484
1533 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0010284.1_g000005.1.cds

Sequence Viewer

Length: 1533 bp
atgatggagtcatctccagcgtctagtctcctccctcaacaacaccacgcctacgtctctgagctcctctccttccccctagctcgccttaacaaggaaccggagcttctccggctccacggggaccgaatccagagtcaaatccaagacttgatggctggtaattaccgagcattagttcacgctgcgcatacctctttgtcagttcaagacgaactatcttccattgacaagaatcttaaatctctgacgttggagaagatccctgagttaacgaatgcatgcaccgagtttgttgacactttggagaagaggaagaagatgaaccaaacacagcacttacttgaaatccctcaactaatggaaacatgtgtgagggatgagaactatgatgaggctctagagttagaagcctttgttcgcaagctttcgactatgcaccccaaattggcagctgttagagatctggctgaacaggtcaggaagatcactcaatctcttgtgtcccagcttcttcagaaacttcgttcggatttcgagaaacccgaggctgaatactgcctccagattgtaggatatttacgtagagcagaagtgtatagtgagtatgaactgcggttgcagtttttgagatgtaggcaagcatggcttacaggaatgttggaggatttggatgagagaaacccttacgagtacctcaaggggatgattagttgtcacagaaatcatctagttgatattgttaatcaatgtgtgttggtaaattacgatgaagatgatgatggtcttctcaatagttggcttatgcaccaagtaacctcacaccttgagactctcaaaattctgcttccaaatataagcgacggagtgtcgctatctaatattctagaggaatccatgtattgcggcatggtgcttggtagggtgattgggctagatttcaggggtatgctaccaccaattttcgaagaggcggttgtcaacatgttctcaaacaatgtgagtagagcagttgaaggttttcagttggttttggattcacatcgttgggttctactaccagctatagcaaatagtagtgttggtggtggtggtaatgacgatgatgatgacgtaattgaacctccgtattgtcttatggatcatccacctctggctgtttttgttaatggagtgtctgcggcgatgaatgagctccggccctgtgcacccttaagtttgaagcatgagctttctaaagagttgatcaagggattgaaggctgtttccgactatttgatgacttacaatgcaacatctgggatactactgagagaaaacaaagagtctgaactttttctctcactttgtcaagcattcattgagattacttacccacattgtgccaagtgctttggtctctgttaccctggcggagctgcttcaatcatggatgctaagagtttatgtgacagcattcgccgcctagtgatgacagtctctcccagaccaaaacctccaattggtaatagagacggaaatgaaaactactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

510

Amino Acids

57.56

Weight (kDa)

5.2

Isoelectric Point (pI)

46.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018031)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g33140
rosa_chinensis RchiOBHm_Chr4g0442191
rosa_laevigata RLG00000006025 RLG00000006028 RLG00000006031
rosa_multiflora Rmu_sc0010284.1_g000005
rosa_roxburghii Rroxscaffold_5G00383110
rosa_rugosa Rorug04G0339400
rosa_samantha Rh4BG404800 Rh4CG419800
rosa_wichuraiana Rw4G033810

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 189
AciI CCGC 6 cut(s) 616, 906, 974, 1181, 1413, 1462
AclWI GGATC 2 cut(s) 256, 1149
AcsI RAATTY 1 cut(s) 840
AcuI CTGAAG 1 cut(s) 500
AdeI CACNNNGTG 1 cut(s) 1382
AfaI GTAC 1 cut(s) 695
AfiI CCNNNNNNNGG 3 cut(s) 94, 448, 1502
AflII CTTAAG 1 cut(s) 1213
AflIII ACRYGT 2 cut(s) 368, 984
AgsI TTSAA 7 cut(s) 209, 347, 1016, 1121, 1222, 1258, 1425
AhdI GACNNNNNGTC 1 cut(s) 868
AjnI CCWGG 1 cut(s) 1408
Alw21I GWGCWC 3 cut(s) 66, 1197, 1210
Alw26I GTCTC 6 cut(s) 32, 61, 824, 1403, 1483, 1506
Alw44I GTGCAC 1 cut(s) 1206
AlwI GGATC 2 cut(s) 256, 1149
Ama87I CYCGRG 1 cut(s) 545
AoxI GGCC 1 cut(s) 1199
ApaLI GTGCAC 1 cut(s) 1206
ApeKI GCWGC 3 cut(s) 185, 452, 1418
ApoI RAATTY 1 cut(s) 840
ArsI GACNNNNNNTTYG 2 cut(s) 121, 153
Asp700I GAANNNNTTC 2 cut(s) 1020, 1335
AspLEI GCGC 1 cut(s) 190
AspS9I GGNCC 2 cut(s) 124, 1200
AsuHPI GGTGA 1 cut(s) 937
AsuII TTCGAA 1 cut(s) 966
AvaI CYCGRG 1 cut(s) 545
AvaII GGWCC 1 cut(s) 124
BaeGI GKGCMC 1 cut(s) 1210
BanII GRGCYC 2 cut(s) 66, 1197
BbsI GAAGAC 1 cut(s) 779
Bbv12I GWGCWC 3 cut(s) 66, 1197, 1210
BbvI GCAGC 3 cut(s) 172, 464, 1405
BccI CCATC 2 cut(s) 148, 776
BciT130I CCWGG 1 cut(s) 1410
BciVI GTATCC 1 cut(s) 1296
BclI TGATCA 1 cut(s) 1245
BcoDI GTCTC 6 cut(s) 32, 61, 824, 1403, 1483, 1506
BfaI CTAG 7 cut(s) 24, 80, 401, 731, 887, 935, 1466
BfmI CTRYAG 1 cut(s) 1065
BfrI CTTAAG 1 cut(s) 1213
BfuI GTATCC 1 cut(s) 1296
BglII AGATCT 1 cut(s) 463
BisI GCNGC 6 cut(s) 186, 453, 907, 1182, 1419, 1462
BlsI GCNGC 6 cut(s) 187, 454, 908, 1183, 1420, 1463
Bme1390I CCNGG 1 cut(s) 1410
Bme18I GGWCC 1 cut(s) 124
BmeRI GACNNNNNGTC 1 cut(s) 868
BmeT110I CYCGRG 1 cut(s) 545
BmgT120I GGNCC 2 cut(s) 124, 1200
BmiI GGNNCC 3 cut(s) 99, 116, 125
BmrFI CCNGG 1 cut(s) 1410
BmsI GCATC 1 cut(s) 1423
BpiI GAAGAC 1 cut(s) 779
BplI GAGNNNNNCTC 2 cut(s) 53, 85
BpmI CTGGAG 1 cut(s) 548
Bpu14I TTCGAA 1 cut(s) 966
BpuEI CTTGAG 2 cut(s) 683, 848
BsaAI YACGTR 1 cut(s) 584
BsaBI GATNNNNATC 1 cut(s) 1041
BsaI GGTCTC 1 cut(s) 1403
BsaJI CCNNGG 3 cut(s) 118, 546, 1408
BsaWI WCCGGW 1 cut(s) 100
BsaXI ACNNNNNCTCC 2 cut(s) 1465, 1495
Bsc4I CCNNNNNNNGG 3 cut(s) 94, 448, 1502
Bse8I GATNNNNATC 1 cut(s) 1041
BseBI CCWGG 1 cut(s) 1410
BseDI CCNNGG 3 cut(s) 118, 546, 1408
BseGI GGATG 5 cut(s) 385, 679, 711, 1144, 1438
BseJI GATNNNNATC 1 cut(s) 1041
BseLI CCNNNNNNNGG 3 cut(s) 94, 448, 1502
BseMII CTCAG 3 cut(s) 51, 258, 1301
BseRI GAGGAG 2 cut(s) 20, 56
BseSI GKGCMC 1 cut(s) 1210
BseXI GCAGC 3 cut(s) 172, 464, 1405
BseYI CCCAGC 1 cut(s) 507
BshFI GGCC 1 cut(s) 1201
BsiHKAI GWGCWC 3 cut(s) 66, 1197, 1210
BsiHKCI CYCGRG 1 cut(s) 545
BsiSI CCGG 3 cut(s) 101, 112, 1198
BslFI GGGAC 2 cut(s) 137, 490
BslI CCNNNNNNNGG 3 cut(s) 94, 448, 1502
BsmAI GTCTC 6 cut(s) 32, 61, 824, 1403, 1483, 1506
BsmBI CGTCTC 2 cut(s) 61, 1506
BsmFI GGGAC 2 cut(s) 137, 490
BsmI GAATGC 3 cut(s) 283, 1355, 1455
BsnI GGCC 1 cut(s) 1201
Bso31I GGTCTC 1 cut(s) 1403
BsoBI CYCGRG 1 cut(s) 545
Bsp119I TTCGAA 1 cut(s) 966
Bsp1286I GDGCHC 3 cut(s) 66, 1197, 1210
Bsp143I GATC 5 cut(s) 261, 463, 486, 1141, 1245
BspACI CCGC 6 cut(s) 616, 906, 974, 1181, 1413, 1462
BspANI GGCC 1 cut(s) 1201
BspCNI CTCAG 3 cut(s) 52, 259, 1302
BspLI GGNNCC 3 cut(s) 99, 116, 125
BspPI GGATC 2 cut(s) 256, 1149
BspT104I TTCGAA 1 cut(s) 966
BspTI CTTAAG 1 cut(s) 1213
BspTNI GGTCTC 1 cut(s) 1403
BssECI CCNNGG 3 cut(s) 118, 546, 1408
BssMI GATC 5 cut(s) 261, 463, 486, 1141, 1245
Bst2UI CCWGG 1 cut(s) 1410
Bst4CI ACNGT 1 cut(s) 1477
Bst6I CTCTTC 2 cut(s) 305, 963
BstAFI CTTAAG 1 cut(s) 1213
BstBAI YACGTR 1 cut(s) 584
BstBI TTCGAA 1 cut(s) 966
BstC8I GCNNGC 4 cut(s) 85, 283, 425, 642
BstDEI CTNAG 4 cut(s) 60, 267, 1310, 1437
BstDSI CCRYGG 1 cut(s) 118
BstENI CCTNNNNNAGG 1 cut(s) 92
BstF5I GGATG 5 cut(s) 385, 679, 711, 1144, 1438
BstHHI GCGC 1 cut(s) 190
BstKTI GATC 5 cut(s) 264, 466, 489, 1144, 1248
BstMAI GTCTC 6 cut(s) 32, 61, 824, 1403, 1483, 1506
BstMBI GATC 5 cut(s) 261, 463, 486, 1141, 1245
BstMWI GCNNNNNNNGC 3 cut(s) 112, 646, 1461
BstNI CCWGG 1 cut(s) 1410
BstNSI RCATGY 3 cut(s) 285, 372, 988
BstSCI CCNGG 1 cut(s) 1408
BstSFI CTRYAG 1 cut(s) 1065
BstSLI GKGCMC 1 cut(s) 1210
BstSNI TACGTA 1 cut(s) 584
BstV1I GCAGC 3 cut(s) 172, 464, 1405
BstV2I GAAGAC 1 cut(s) 779
BstX2I RGATCY 2 cut(s) 261, 463
BstYI RGATCY 2 cut(s) 261, 463
BsuI GTATCC 1 cut(s) 1296
BsuRI GGCC 1 cut(s) 1201
BtgI CCRYGG 1 cut(s) 118
BtgZI GCGATG 1 cut(s) 1199
BtsCI GGATG 5 cut(s) 385, 679, 711, 1144, 1438
Cac8I GCNNGC 4 cut(s) 85, 283, 425, 642
CfoI GCGC 1 cut(s) 190
Cfr13I GGNCC 2 cut(s) 124, 1200
CseI GACGC 1 cut(s) 9
Csp6I GTAC 1 cut(s) 694
CviAII CATG 8 cut(s) 282, 369, 645, 898, 910, 985, 1226, 1429
CviQI GTAC 1 cut(s) 694
DdeI CTNAG 4 cut(s) 60, 267, 1310, 1437
DpnI GATC 5 cut(s) 263, 465, 488, 1143, 1247
DpnII GATC 5 cut(s) 261, 463, 486, 1141, 1245
DraIII CACNNNGTG 1 cut(s) 1382
DriI GACNNNNNGTC 1 cut(s) 868
Eam1104I CTCTTC 2 cut(s) 305, 963
Eam1105I GACNNNNNGTC 1 cut(s) 868
EarI CTCTTC 2 cut(s) 305, 963
EciI GGCGGA 1 cut(s) 1428
Ecl136II GAGCTC 2 cut(s) 64, 1195
Eco105I TACGTA 1 cut(s) 584
Eco24I GRGCYC 2 cut(s) 66, 1197
Eco31I GGTCTC 1 cut(s) 1403
Eco47I GGWCC 1 cut(s) 124
Eco53kI GAGCTC 2 cut(s) 64, 1195
Eco57I CTGAAG 1 cut(s) 500
Eco88I CYCGRG 1 cut(s) 545
EcoICRI GAGCTC 2 cut(s) 64, 1195
EcoNI CCTNNNNNAGG 1 cut(s) 92
EcoRII CCWGG 1 cut(s) 1408
EcoT22I ATGCAT 1 cut(s) 283
EcoT38I GRGCYC 2 cut(s) 66, 1197
Esp3I CGTCTC 2 cut(s) 61, 1506
FaeI CATG 8 cut(s) 285, 372, 648, 901, 913, 988, 1229, 1432
FalI AAGNNNNNCTT 2 cut(s) 633, 665
FaqI GGGAC 2 cut(s) 137, 490
FatI CATG 8 cut(s) 281, 368, 644, 897, 909, 984, 1225, 1428
FbaI TGATCA 1 cut(s) 1245
Fnu4HI GCNGC 6 cut(s) 186, 453, 907, 1182, 1419, 1462
FokI GGATG 5 cut(s) 392, 686, 718, 1131, 1445
FriOI GRGCYC 2 cut(s) 66, 1197
Fsp4HI GCNGC 6 cut(s) 186, 453, 907, 1182, 1419, 1462
FspBI CTAG 7 cut(s) 24, 80, 401, 731, 887, 935, 1466
FspI TGCGCA 1 cut(s) 189
GlaI GCGC 1 cut(s) 189
GluI GCNGC 6 cut(s) 186, 453, 907, 1182, 1419, 1462
GsaI CCCAGC 1 cut(s) 511
GsuI CTGGAG 1 cut(s) 548
HaeIII GGCC 1 cut(s) 1201
HapII CCGG 3 cut(s) 101, 112, 1198
HgaI GACGC 1 cut(s) 9
HhaI GCGC 1 cut(s) 190
Hin1II CATG 8 cut(s) 285, 372, 648, 901, 913, 988, 1229, 1432
Hin6I GCGC 1 cut(s) 188
HinP1I GCGC 1 cut(s) 188
HincII GTYRAC 3 cut(s) 273, 298, 982
HindII GTYRAC 3 cut(s) 273, 298, 982
HindIII AAGCTT 1 cut(s) 425
HinfI GANTC 8 cut(s) 8, 129, 136, 235, 832, 893, 1037, 1325
HpaI GTTAAC 1 cut(s) 273
HpaII CCGG 3 cut(s) 101, 112, 1198
HphI GGTGA 1 cut(s) 937
Hpy166II GTNNAC 5 cut(s) 181, 273, 298, 982, 1208
Hpy188I TCNGA 6 cut(s) 61, 249, 519, 532, 1270, 1330
Hpy188III TCNNGA 7 cut(s) 133, 209, 401, 481, 538, 565, 887
Hpy8I GTNNAC 5 cut(s) 181, 273, 298, 982, 1208
Hpy99I CGWCG 1 cut(s) 866
HpyAV CCTTC 3 cut(s) 82, 1010, 1252
HpyCH4III ACNGT 1 cut(s) 1477
HpyCH4IV ACGT 4 cut(s) 54, 251, 583, 1113
HpyCH4V TGCA 7 cut(s) 281, 285, 439, 622, 808, 1208, 1292
HpyF10VI GCNNNNNNNGC 3 cut(s) 112, 646, 1461
HpyF3I CTNAG 4 cut(s) 60, 267, 1310, 1437
HpySE526I ACGT 4 cut(s) 54, 251, 583, 1113
Hsp92II CATG 8 cut(s) 285, 372, 648, 901, 913, 988, 1229, 1432
HspAI GCGC 1 cut(s) 188
Ksp22I TGATCA 1 cut(s) 1245
KspAI GTTAAC 1 cut(s) 273
Kzo9I GATC 5 cut(s) 261, 463, 486, 1141, 1245
LmnI GCTCC 5 cut(s) 69, 103, 120, 1200, 1415
Lsp1109I GCAGC 3 cut(s) 172, 464, 1405
LweI GCATC 1 cut(s) 1423
MaeI CTAG 7 cut(s) 24, 80, 401, 731, 887, 935, 1466
MaeII ACGT 4 cut(s) 54, 251, 583, 1113
MaeIII GTNAC 4 cut(s) 716, 814, 1403, 1448
MalI GATC 5 cut(s) 263, 465, 488, 1143, 1247
MboI GATC 5 cut(s) 261, 463, 486, 1141, 1245
MfeI CAATTG 1 cut(s) 1500
MflI RGATCY 2 cut(s) 261, 463
MhlI GDGCHC 3 cut(s) 66, 1197, 1210
MluCI AATT 7 cut(s) 163, 446, 763, 840, 960, 1116, 1500
MlyI GAGTC 4 cut(s) 17, 145, 826, 1334
MmeI TCCRAC 3 cut(s) 234, 642, 1293
Mph1103I ATGCAT 1 cut(s) 283
MroXI GAANNNNTTC 2 cut(s) 1020, 1335
MseI TTAA 6 cut(s) 90, 240, 272, 744, 1167, 1214
MspA1I CMGCKG 1 cut(s) 455
MspCI CTTAAG 1 cut(s) 1213
MspI CCGG 3 cut(s) 101, 112, 1198
MspR9I CCNGG 1 cut(s) 1410
MunI CAATTG 1 cut(s) 1500
Mva1269I GAATGC 3 cut(s) 283, 1355, 1455
MvaI CCWGG 1 cut(s) 1410
MwoI GCNNNNNNNGC 3 cut(s) 112, 646, 1461
NdeII GATC 5 cut(s) 261, 463, 486, 1141, 1245
NlaIII CATG 8 cut(s) 285, 372, 648, 901, 913, 988, 1229, 1432
NlaIV GGNNCC 3 cut(s) 99, 116, 125
NmuCI GTSAC 2 cut(s) 716, 1448
NsbI TGCGCA 1 cut(s) 189
NsiI ATGCAT 1 cut(s) 283
NspI RCATGY 3 cut(s) 285, 372, 988
NspV TTCGAA 1 cut(s) 966
PaeI GCATGC 1 cut(s) 285
PciI ACATGT 2 cut(s) 368, 984
PcsI WCGNNNNNNNCGW 1 cut(s) 543
PctI GAATGC 3 cut(s) 283, 1355, 1455
PdmI GAANNNNTTC 2 cut(s) 1020, 1335
PfeI GAWTC 4 cut(s) 129, 235, 893, 1037
PkrI GCNGC 6 cut(s) 187, 454, 908, 1183, 1420, 1463
PleI GAGTC 4 cut(s) 16, 144, 826, 1333
PpsI GAGTC 4 cut(s) 16, 144, 826, 1333
Ppu21I YACGTR 1 cut(s) 584
PscI ACATGT 2 cut(s) 368, 984
Psp124BI GAGCTC 2 cut(s) 66, 1197
Psp6I CCWGG 1 cut(s) 1408
PspFI CCCAGC 1 cut(s) 507
PspGI CCWGG 1 cut(s) 1408
PspN4I GGNNCC 3 cut(s) 99, 116, 125
PspPI GGNCC 2 cut(s) 124, 1200
PsuI RGATCY 2 cut(s) 261, 463
PvuII CAGCTG 1 cut(s) 455
RsaI GTAC 1 cut(s) 695
RsaNI GTAC 1 cut(s) 694
SacI GAGCTC 2 cut(s) 66, 1197
SaqAI TTAA 6 cut(s) 90, 240, 272, 744, 1167, 1214
SatI GCNGC 6 cut(s) 186, 453, 907, 1182, 1419, 1462
Sau3AI GATC 5 cut(s) 261, 463, 486, 1141, 1245
Sau96I GGNCC 2 cut(s) 124, 1200
SchI GAGTC 4 cut(s) 17, 145, 826, 1334
ScrFI CCNGG 1 cut(s) 1410
SduI GDGCHC 3 cut(s) 66, 1197, 1210
SfaNI GCATC 1 cut(s) 1423
SfcI CTRYAG 1 cut(s) 1065
SfuI TTCGAA 1 cut(s) 966
SinI GGWCC 1 cut(s) 124
SmlI CTYRAG 3 cut(s) 698, 827, 1213
SmoI CTYRAG 3 cut(s) 698, 827, 1213
SnaBI TACGTA 1 cut(s) 584
SphI GCATGC 1 cut(s) 285
Sse9I AATT 7 cut(s) 163, 446, 763, 840, 960, 1116, 1500
SsiI CCGC 6 cut(s) 616, 906, 974, 1181, 1413, 1462
SspI AATATT 1 cut(s) 883
SspMI CTAG 7 cut(s) 24, 80, 401, 731, 887, 935, 1466
SstI GAGCTC 2 cut(s) 66, 1197
StyD4I CCNGG 1 cut(s) 1408
TaaI ACNGT 1 cut(s) 1477
TaiI ACGT 4 cut(s) 57, 254, 586, 1116
TaqI TCGA 3 cut(s) 431, 537, 966
TaqII GACCGA 1 cut(s) 141
TasI AATT 7 cut(s) 163, 446, 763, 840, 960, 1116, 1500
TauI GCSGC 3 cut(s) 909, 1184, 1464
TfiI GAWTC 4 cut(s) 129, 235, 893, 1037
Tru1I TTAA 6 cut(s) 90, 240, 272, 744, 1167, 1214
Tru9I TTAA 6 cut(s) 90, 240, 272, 744, 1167, 1214
TseFI GTSAC 2 cut(s) 716, 1448
TseI GCWGC 3 cut(s) 185, 452, 1418
Tsp45I GTSAC 2 cut(s) 716, 1448
TspDTI ATGAA 5 cut(s) 338, 624, 786, 1202, 1348
TspGWI ACGGA 3 cut(s) 879, 1116, 1530
Vha464I CTTAAG 1 cut(s) 1213
VneI GTGCAC 1 cut(s) 1206
VpaK11BI GGWCC 1 cut(s) 124
XagI CCTNNNNNAGG 1 cut(s) 92
XapI RAATTY 1 cut(s) 840
XbaI TCTAGA 2 cut(s) 400, 886
XceI RCATGY 3 cut(s) 285, 372, 988
XmnI GAANNNNTTC 2 cut(s) 1020, 1335
XspI CTAG 7 cut(s) 24, 80, 401, 731, 887, 935, 1466
Zsp2I ATGCAT 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.