Rmu_sc0011237.1_g000003

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011237.1
OG0025484
Physical Location & Seq
Reverse (-)
6196 .. 6981
786 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011237.1_g000003.1.cds

Sequence Viewer

Length: 786 bp
atgcctcaatggcctcctccatggctagccttacggcagccctttctcatgttatttctgcgcaagttttgcttggattggtggggctggaagcgctgcaaatcaatcgctagtacatggtggggactctttggacccaaagccaagtttcccggtttcaaaggtagaattcccatcatctggaggatcaaatttggtttgactatacacgatgtgggagatcgctttgtgttccaattcgaacgtaaagcagagcgaaataggatcctgcatggtgggatgtggttctataggaataccatgctcatacttagagaatttgatggattgggatcggtgtcgaaggtcctttttaatttcttggagacctgggttgcggttaaagggctggctttaattctacgcaacaaaatggccttgcacctggtaggttctatgatcgaacatgtacttcgtttcaatcagactgcctttcataggaaggaggaggaacatcatattagactaatatttgatgcgcaacgtcgagtccgtttttggaaattgtttgagttctcaccggtggtggaacctgaattgcattttgtttatgaaaagatcaagggttgctgcataaattgtggtgttttggaacatgatgcatcgggttttgattacttcttggtgaaggagaaagaagaaatcctagcaaagcctccgacagcagctttggctggactgaccttgactttgagttcgcatatcagtaaccctagacaggaggagggaggaagcagatcagattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4283 Exo_endo_phos_2 RNase_H RVT_1 zf-CCHC_4

Protein Analysis

261

Amino Acids

30.65

Weight (kDa)

9.68

Isoelectric Point (pI)

44.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025484)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000579.1_g000010 Rmu_sc0002177.1_g000005 Rmu_sc0011237.1_g000003

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 2 cut(s) 62, 519
AccB7I CCANNNNNTGG 1 cut(s) 180
AciI CCGC 1 cut(s) 377
AclWI GGATC 4 cut(s) 194, 259, 272, 340
AcsI RAATTY 3 cut(s) 168, 191, 317
AdeI CACNNNGTG 1 cut(s) 214
AfaI GTAC 2 cut(s) 115, 450
AfeI AGCGCT 1 cut(s) 95
AfiI CCNNNNNNNGG 3 cut(s) 180, 477, 757
AflIII ACRYGT 1 cut(s) 445
AgeI ACCGGT 1 cut(s) 559
AgsI TTSAA 2 cut(s) 160, 460
AjnI CCWGG 2 cut(s) 368, 423
AluBI AGCT 1 cut(s) 707
AluI AGCT 1 cut(s) 707
Alw26I GTCTC 1 cut(s) 359
AlwI GGATC 4 cut(s) 194, 259, 272, 340
Aor51HI AGCGCT 1 cut(s) 95
AoxI GGCC 2 cut(s) 11, 414
ApeKI GCWGC 4 cut(s) 37, 96, 609, 704
ApoI RAATTY 3 cut(s) 168, 191, 317
ArsI GACNNNNNNTTYG 6 cut(s) 691, 712, 718, 723, 744, 750
AsiGI ACCGGT 1 cut(s) 559
AspLEI GCGC 3 cut(s) 63, 96, 520
AspS9I GGNCC 2 cut(s) 134, 346
AsuC2I CCSGG 1 cut(s) 153
AsuHPI GGTGA 2 cut(s) 549, 676
AsuII TTCGAA 1 cut(s) 240
AsuNHI GCTAGC 1 cut(s) 25
AvaII GGWCC 2 cut(s) 134, 346
BamHI GGATCC 1 cut(s) 264
BbvI GCAGC 4 cut(s) 49, 83, 596, 716
BccI CCATC 2 cut(s) 182, 317
BceAI ACGGC 1 cut(s) 50
BcgI CGANNNNNNTGC 2 cut(s) 88, 122
BciT130I CCWGG 2 cut(s) 370, 425
BcnI CCSGG 1 cut(s) 153
BcoDI GTCTC 1 cut(s) 359
BfaI CTAG 4 cut(s) 26, 111, 686, 753
BfmI CTRYAG 1 cut(s) 289
BfoI RGCGCY 1 cut(s) 97
BglI GCCNNNNNGGC 1 cut(s) 10
BisI GCNGC 4 cut(s) 38, 97, 610, 705
BlsI GCNGC 4 cut(s) 39, 98, 611, 706
Bme1390I CCNGG 3 cut(s) 153, 370, 425
Bme18I GGWCC 2 cut(s) 134, 346
BmgT120I GGNCC 2 cut(s) 134, 346
BmiI GGNNCC 3 cut(s) 136, 266, 570
BmrFI CCNGG 3 cut(s) 153, 370, 425
BmsI GCATC 3 cut(s) 505, 628, 650
BmtI GCTAGC 1 cut(s) 29
BpmI CTGGAG 1 cut(s) 202
Bpu14I TTCGAA 1 cut(s) 240
BpuMI CCSGG 1 cut(s) 153
BsaBI GATNNNNATC 1 cut(s) 331
BsaI GGTCTC 1 cut(s) 359
BsaJI CCNNGG 2 cut(s) 20, 369
BsaWI WCCGGW 1 cut(s) 559
Bsc4I CCNNNNNNNGG 3 cut(s) 180, 477, 757
Bse118I RCCGGY 1 cut(s) 559
Bse8I GATNNNNATC 1 cut(s) 331
BseBI CCWGG 2 cut(s) 370, 425
BseDI CCNNGG 2 cut(s) 20, 369
BseGI GGATG 1 cut(s) 285
BseJI GATNNNNATC 1 cut(s) 331
BseLI CCNNNNNNNGG 3 cut(s) 180, 477, 757
BseRI GAGGAG 3 cut(s) 6, 500, 776
BseXI GCAGC 4 cut(s) 49, 83, 596, 716
BshFI GGCC 2 cut(s) 13, 416
BshTI ACCGGT 1 cut(s) 559
BsiSI CCGG 2 cut(s) 153, 560
BslFI GGGAC 1 cut(s) 138
BslI CCNNNNNNNGG 3 cut(s) 180, 477, 757
BsmAI GTCTC 1 cut(s) 359
BsmFI GGGAC 1 cut(s) 138
BsnI GGCC 2 cut(s) 13, 416
Bso31I GGTCTC 1 cut(s) 359
Bsp119I TTCGAA 1 cut(s) 240
Bsp143I GATC 7 cut(s) 186, 220, 264, 332, 438, 597, 776
Bsp19I CCATGG 1 cut(s) 20
BspACI CCGC 1 cut(s) 377
BspANI GGCC 2 cut(s) 13, 416
BspLI GGNNCC 3 cut(s) 136, 266, 570
BspOI GCTAGC 1 cut(s) 29
BspPI GGATC 4 cut(s) 194, 259, 272, 340
BspT104I TTCGAA 1 cut(s) 240
BspTNI GGTCTC 1 cut(s) 359
BsrFI RCCGGY 1 cut(s) 559
BssAI RCCGGY 1 cut(s) 559
BssECI CCNNGG 2 cut(s) 20, 369
BssMI GATC 7 cut(s) 186, 220, 264, 332, 438, 597, 776
BssT1I CCWWGG 1 cut(s) 20
Bst2UI CCWGG 2 cut(s) 370, 425
BstAPI GCANNNNNTGC 1 cut(s) 69
BstBI TTCGAA 1 cut(s) 240
BstC8I GCNNGC 2 cut(s) 27, 390
BstDEI CTNAG 1 cut(s) 311
BstDSI CCRYGG 1 cut(s) 20
BstENI CCTNNNNNAGG 1 cut(s) 475
BstF5I GGATG 1 cut(s) 285
BstH2I RGCGCY 1 cut(s) 97
BstHHI GCGC 3 cut(s) 63, 96, 520
BstKTI GATC 7 cut(s) 189, 223, 267, 335, 441, 600, 779
BstMAI GTCTC 1 cut(s) 359
BstMBI GATC 7 cut(s) 186, 220, 264, 332, 438, 597, 776
BstMWI GCNNNNNNNGC 4 cut(s) 10, 69, 93, 710
BstNI CCWGG 2 cut(s) 370, 425
BstNSI RCATGY 1 cut(s) 449
BstSCI CCNGG 3 cut(s) 151, 368, 423
BstSFI CTRYAG 1 cut(s) 289
BstV1I GCAGC 4 cut(s) 49, 83, 596, 716
BstX2I RGATCY 1 cut(s) 264
BstYI RGATCY 1 cut(s) 264
BsuRI GGCC 2 cut(s) 13, 416
BtgI CCRYGG 1 cut(s) 20
BtsCI GGATG 1 cut(s) 285
Cac8I GCNNGC 2 cut(s) 27, 390
CfoI GCGC 3 cut(s) 63, 96, 520
Cfr10I RCCGGY 1 cut(s) 559
Cfr13I GGNCC 2 cut(s) 134, 346
CsiI ACCWGGT 1 cut(s) 423
Csp6I GTAC 2 cut(s) 114, 449
CspAI ACCGGT 1 cut(s) 559
CviAII CATG 7 cut(s) 21, 49, 117, 272, 301, 446, 635
CviQI GTAC 2 cut(s) 114, 449
DdeI CTNAG 1 cut(s) 311
DpnI GATC 7 cut(s) 188, 222, 266, 334, 440, 599, 778
DpnII GATC 7 cut(s) 186, 220, 264, 332, 438, 597, 776
DraIII CACNNNGTG 1 cut(s) 214
Eco130I CCWWGG 1 cut(s) 20
Eco31I GGTCTC 1 cut(s) 359
Eco47I GGWCC 2 cut(s) 134, 346
Eco47III AGCGCT 1 cut(s) 95
EcoNI CCTNNNNNAGG 1 cut(s) 475
EcoO109I RGGNCCY 1 cut(s) 346
EcoRI GAATTC 1 cut(s) 168
EcoRII CCWGG 2 cut(s) 368, 423
EcoT14I CCWWGG 1 cut(s) 20
EcoT22I ATGCAT 1 cut(s) 643
ErhI CCWWGG 1 cut(s) 20
FaeI CATG 7 cut(s) 24, 52, 120, 275, 304, 449, 638
FalI AAGNNNNNCTT 2 cut(s) 56, 88
FaqI GGGAC 1 cut(s) 138
FatI CATG 7 cut(s) 20, 48, 116, 271, 300, 445, 634
Fnu4HI GCNGC 4 cut(s) 38, 97, 610, 705
FokI GGATG 1 cut(s) 292
Fsp4HI GCNGC 4 cut(s) 38, 97, 610, 705
FspBI CTAG 4 cut(s) 26, 111, 686, 753
FspI TGCGCA 2 cut(s) 62, 519
GlaI GCGC 3 cut(s) 62, 95, 519
GluI GCNGC 4 cut(s) 38, 97, 610, 705
GsuI CTGGAG 1 cut(s) 202
HaeII RGCGCY 1 cut(s) 97
HaeIII GGCC 2 cut(s) 13, 416
HapII CCGG 2 cut(s) 153, 560
HhaI GCGC 3 cut(s) 63, 96, 520
Hin1II CATG 7 cut(s) 24, 52, 120, 275, 304, 449, 638
Hin6I GCGC 3 cut(s) 61, 94, 518
HinP1I GCGC 3 cut(s) 61, 94, 518
HinfI GANTC 2 cut(s) 126, 528
HpaII CCGG 2 cut(s) 153, 560
HphI GGTGA 2 cut(s) 549, 676
Hpy188I TCNGA 3 cut(s) 465, 699, 781
Hpy188III TCNNGA 1 cut(s) 181
Hpy99I CGWCG 1 cut(s) 528
HpyAV CCTTC 3 cut(s) 337, 475, 661
HpyCH4IV ACGT 2 cut(s) 244, 523
HpyCH4V TGCA 6 cut(s) 99, 271, 421, 580, 612, 641
HpyF10VI GCNNNNNNNGC 4 cut(s) 10, 69, 93, 710
HpyF3I CTNAG 1 cut(s) 311
HpySE526I ACGT 2 cut(s) 244, 523
Hsp92II CATG 7 cut(s) 24, 52, 120, 275, 304, 449, 638
HspAI GCGC 3 cut(s) 61, 94, 518
Kzo9I GATC 7 cut(s) 186, 220, 264, 332, 438, 597, 776
Lsp1109I GCAGC 4 cut(s) 49, 83, 596, 716
LweI GCATC 3 cut(s) 505, 628, 650
MabI ACCWGGT 1 cut(s) 423
MaeI CTAG 4 cut(s) 26, 111, 686, 753
MaeII ACGT 2 cut(s) 244, 523
MaeIII GTNAC 1 cut(s) 746
MalI GATC 7 cut(s) 188, 222, 266, 334, 440, 599, 778
MboI GATC 7 cut(s) 186, 220, 264, 332, 438, 597, 776
MboII GAAGA 1 cut(s) 689
MflI RGATCY 1 cut(s) 264
MluCI AATT 9 cut(s) 168, 191, 236, 317, 355, 396, 542, 575, 616
MlyI GAGTC 2 cut(s) 120, 537
MmeI TCCRAC 1 cut(s) 722
Mph1103I ATGCAT 1 cut(s) 643
MseI TTAA 3 cut(s) 354, 381, 395
MspI CCGG 2 cut(s) 153, 560
MspR9I CCNGG 3 cut(s) 153, 370, 425
MvaI CCWGG 2 cut(s) 370, 425
MwoI GCNNNNNNNGC 4 cut(s) 10, 69, 93, 710
NciI CCSGG 1 cut(s) 153
NcoI CCATGG 1 cut(s) 20
NdeII GATC 7 cut(s) 186, 220, 264, 332, 438, 597, 776
NheI GCTAGC 1 cut(s) 25
NlaIII CATG 7 cut(s) 24, 52, 120, 275, 304, 449, 638
NlaIV GGNNCC 3 cut(s) 136, 266, 570
NsbI TGCGCA 2 cut(s) 62, 519
NsiI ATGCAT 1 cut(s) 643
NspI RCATGY 1 cut(s) 449
NspV TTCGAA 1 cut(s) 240
PciI ACATGT 1 cut(s) 445
PcsI WCGNNNNNNNCGW 1 cut(s) 529
PflMI CCANNNNNTGG 1 cut(s) 180
PinAI ACCGGT 1 cut(s) 559
PkrI GCNGC 4 cut(s) 39, 98, 611, 706
PleI GAGTC 2 cut(s) 120, 536
PpsI GAGTC 2 cut(s) 120, 536
PpuMI RGGWCCY 1 cut(s) 346
PscI ACATGT 1 cut(s) 445
Psp5II RGGWCCY 1 cut(s) 346
Psp6I CCWGG 2 cut(s) 368, 423
PspGI CCWGG 2 cut(s) 368, 423
PspN4I GGNNCC 3 cut(s) 136, 266, 570
PspPI GGNCC 2 cut(s) 134, 346
PspPPI RGGWCCY 1 cut(s) 346
PsuI RGATCY 1 cut(s) 264
RsaI GTAC 2 cut(s) 115, 450
RsaNI GTAC 2 cut(s) 114, 449
SaqAI TTAA 3 cut(s) 354, 381, 395
SatI GCNGC 4 cut(s) 38, 97, 610, 705
Sau3AI GATC 7 cut(s) 186, 220, 264, 332, 438, 597, 776
Sau96I GGNCC 2 cut(s) 134, 346
SchI GAGTC 2 cut(s) 120, 537
ScrFI CCNGG 3 cut(s) 153, 370, 425
SexAI ACCWGGT 1 cut(s) 423
SfaNI GCATC 3 cut(s) 505, 628, 650
SfcI CTRYAG 1 cut(s) 289
SfuI TTCGAA 1 cut(s) 240
SgrAI CRCCGGYG 1 cut(s) 559
SinI GGWCC 2 cut(s) 134, 346
Sse9I AATT 9 cut(s) 168, 191, 236, 317, 355, 396, 542, 575, 616
SsiI CCGC 1 cut(s) 377
SspI AATATT 1 cut(s) 510
SspMI CTAG 4 cut(s) 26, 111, 686, 753
StyD4I CCNGG 3 cut(s) 151, 368, 423
StyI CCWWGG 1 cut(s) 20
TaiI ACGT 2 cut(s) 247, 526
TaqI TCGA 4 cut(s) 240, 341, 441, 526
TasI AATT 9 cut(s) 168, 191, 236, 317, 355, 396, 542, 575, 616
TatI WGTACW 2 cut(s) 113, 448
Tru1I TTAA 3 cut(s) 354, 381, 395
Tru9I TTAA 3 cut(s) 354, 381, 395
TseI GCWGC 4 cut(s) 37, 96, 609, 704
TspDTI ATGAA 2 cut(s) 464, 606
TspGWI ACGGA 1 cut(s) 521
Van91I CCANNNNNTGG 1 cut(s) 180
VpaK11BI GGWCC 2 cut(s) 134, 346
XagI CCTNNNNNAGG 1 cut(s) 475
XapI RAATTY 3 cut(s) 168, 191, 317
XceI RCATGY 1 cut(s) 449
XspI CTAG 4 cut(s) 26, 111, 686, 753
Zsp2I ATGCAT 1 cut(s) 643
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.