Rmu_sc0012468.1_g000009

metalloendoproteinase 1-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0012468.1
Physical Location & Seq
Reverse (-)
27620 .. 27970
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0012468.1_g000009.1.cds

Sequence Viewer

Length: 351 bp
atggcttcaaaatctagtcttatttctcacttcacactcgctttcctccttctcaccctctttactctcctctcttgtgcaaatgcagaagaaactcacaacaaaacatcatccccagttgagttcgttgagcatctcaacgggtctcacaaaggtgaggtcaaaagcatcagtgacctccaaaaattccttaaaaaatttggtttcttggagttgaactacaagatccacaattattccaatgacgatgaggatttcgtggaggaaggcatcaagactctgaccacctcttgttactatggagttgcattgacattgttgttgtatgggttaatgattcatgatgagtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

13.1

Weight (kDa)

5.43

Isoelectric Point (pI)

37.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022640)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0170261
rosa_multiflora Rmu_sc0012468.1_g000009
rosa_rugosa Rorug02G0547500
rosa_samantha Rh2CG600100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 220
AcsI RAATTY 2 cut(s) 185, 197
AgsI TTSAA 2 cut(s) 9, 217
AleI CACNNNNGTG 1 cut(s) 153
Alw26I GTCTC 1 cut(s) 150
AlwI GGATC 1 cut(s) 220
ApoI RAATTY 2 cut(s) 185, 197
ArsI GACNNNNNNTTYG 2 cut(s) 144, 176
AsuHPI GGTGA 2 cut(s) 46, 167
BcoDI GTCTC 1 cut(s) 150
BfaI CTAG 1 cut(s) 15
BmrI ACTGGG 1 cut(s) 110
BmsI GCATC 3 cut(s) 142, 177, 279
BmuI ACTGGG 1 cut(s) 110
BsaI GGTCTC 1 cut(s) 150
Bse1I ACTGG 1 cut(s) 116
BseGI GGATG 1 cut(s) 110
BseNI ACTGG 1 cut(s) 116
BseRI GAGGAG 1 cut(s) 59
BsmAI GTCTC 1 cut(s) 150
Bso31I GGTCTC 1 cut(s) 150
Bsp143I GATC 1 cut(s) 225
BspHI TCATGA 1 cut(s) 340
BspPI GGATC 1 cut(s) 220
BspTNI GGTCTC 1 cut(s) 150
BsrI ACTGG 1 cut(s) 116
BssMI GATC 1 cut(s) 225
BstF5I GGATG 1 cut(s) 110
BstKTI GATC 1 cut(s) 228
BstMAI GTCTC 1 cut(s) 150
BstMBI GATC 1 cut(s) 225
BstX2I RGATCY 1 cut(s) 225
BstYI RGATCY 1 cut(s) 225
BtsCI GGATG 1 cut(s) 110
BtsIMutI CAGTG 1 cut(s) 178
CciI TCATGA 1 cut(s) 340
CviAII CATG 1 cut(s) 341
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DpnI GATC 1 cut(s) 227
DpnII GATC 1 cut(s) 225
Eco31I GGTCTC 1 cut(s) 150
FaeI CATG 1 cut(s) 344
FaiI YATR 3 cut(s) 300, 327, 342
FatI CATG 1 cut(s) 340
FokI GGATG 1 cut(s) 97
FspBI CTAG 1 cut(s) 15
Hin1II CATG 1 cut(s) 344
HinfI GANTC 2 cut(s) 277, 337
HphI GGTGA 2 cut(s) 46, 167
Hpy188I TCNGA 1 cut(s) 282
Hpy188III TCNNGA 2 cut(s) 274, 341
HpyAV CCTTC 2 cut(s) 59, 260
HpyCH4V TGCA 3 cut(s) 80, 86, 308
Hsp92II CATG 1 cut(s) 344
Kzo9I GATC 1 cut(s) 225
LpnPI CCDG 1 cut(s) 129
LweI GCATC 3 cut(s) 142, 177, 279
MaeI CTAG 1 cut(s) 15
MaeIII GTNAC 2 cut(s) 173, 293
MalI GATC 1 cut(s) 227
MboI GATC 1 cut(s) 225
MboII GAAGA 1 cut(s) 101
MflI RGATCY 1 cut(s) 225
MluCI AATT 3 cut(s) 185, 197, 232
MlyI GAGTC 1 cut(s) 271
MnlI CCTC 8 cut(s) 56, 68, 80, 151, 188, 244, 256, 298
MseI TTAA 2 cut(s) 192, 332
MslI CAYNNNNRTG 1 cut(s) 153
NdeII GATC 1 cut(s) 225
NlaIII CATG 1 cut(s) 344
NmuCI GTSAC 1 cut(s) 173
OliI CACNNNNGTG 1 cut(s) 153
PagI TCATGA 1 cut(s) 340
PfeI GAWTC 1 cut(s) 337
PleI GAGTC 1 cut(s) 271
PpsI GAGTC 1 cut(s) 271
PsuI RGATCY 1 cut(s) 225
RseI CAYNNNNRTG 1 cut(s) 153
SaqAI TTAA 2 cut(s) 192, 332
Sau3AI GATC 1 cut(s) 225
SchI GAGTC 1 cut(s) 271
SetI ASST 4 cut(s) 157, 162, 180, 290
SfaNI GCATC 3 cut(s) 142, 177, 279
SmiMI CAYNNNNRTG 1 cut(s) 153
Sse9I AATT 3 cut(s) 185, 197, 232
SspMI CTAG 1 cut(s) 15
TasI AATT 3 cut(s) 185, 197, 232
TfiI GAWTC 1 cut(s) 337
Tru1I TTAA 2 cut(s) 192, 332
Tru9I TTAA 2 cut(s) 192, 332
TscAI CASTG 1 cut(s) 178
TseFI GTSAC 1 cut(s) 173
Tsp45I GTSAC 1 cut(s) 173
TspDTI ATGAA 1 cut(s) 329
TspRI CASTG 1 cut(s) 178
XapI RAATTY 2 cut(s) 185, 197
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.