Rorug02G0547500

metalloendoproteinase 1-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
67551915 .. 67552491
577 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0547500.1

Sequence Viewer

Length: 264 bp
ATGGCTAAGGCTACCTTGATTCTAGTTGTTTCTCTTCTTCTCATCATTTCCCTAGCTGAGAGTAAACTACTCGGAGTTACGTTTAAAGATGACAATTCAGCCATAGTTTGCAATTCCGTTTATGGTGCAGAGGCTGGTGATACCTGCGGTAGCGTCGTTGATAAGTTCGACTTGAGTCTCGATTTCTTCCTTTCCATCAATCCTAATATCAACTGCGACAGCTTCTTCGTGGGTCAATGGCTTTGTACTGAAGGGACTGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.25

Weight (kDa)

4.05

Isoelectric Point (pI)

20.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022640)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0170261
rosa_multiflora Rmu_sc0012468.1_g000009
rosa_rugosa Rorug02G0547500
rosa_samantha Rh2CG600100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 152
AciI CCGC 1 cut(s) 147
AfaI GTAC 1 cut(s) 247
AluBI AGCT 2 cut(s) 56, 222
AluI AGCT 2 cut(s) 56, 222
Alw26I GTCTC 1 cut(s) 182
AlwNI CAGNNNCTG 1 cut(s) 134
ArsI GACNNNNNNTTYG 2 cut(s) 209, 241
AsuHPI GGTGA 1 cut(s) 149
BccI CCATC 1 cut(s) 203
BcoDI GTCTC 1 cut(s) 182
BfaI CTAG 2 cut(s) 23, 53
BfuAI ACCTGC 1 cut(s) 152
BoxI GACNNNNGTC 1 cut(s) 174
Bpu10I CCTNAGC 1 cut(s) 6
BpuEI CTTGAG 1 cut(s) 193
BseMII CTCAG 1 cut(s) 48
BsgI GTGCAG 1 cut(s) 147
BsmAI GTCTC 1 cut(s) 182
BspACI CCGC 1 cut(s) 147
BspCNI CTCAG 1 cut(s) 49
BspMI ACCTGC 1 cut(s) 152
Bst6I CTCTTC 1 cut(s) 39
BstDEI CTNAG 2 cut(s) 6, 57
BstMAI GTCTC 1 cut(s) 182
BstPAI GACNNNNGTC 1 cut(s) 174
BveI ACCTGC 1 cut(s) 152
CaiI CAGNNNCTG 1 cut(s) 134
CseI GACGC 1 cut(s) 142
Csp6I GTAC 1 cut(s) 246
CviJI RGCY 7 cut(s) 5, 11, 56, 101, 134, 222, 241
CviKI_1 RGCY 7 cut(s) 5, 11, 56, 101, 134, 222, 241
CviQI GTAC 1 cut(s) 246
DdeI CTNAG 2 cut(s) 6, 57
DraI TTTAAA 1 cut(s) 85
Eam1104I CTCTTC 1 cut(s) 39
EarI CTCTTC 1 cut(s) 39
FaiI YATR 3 cut(s) 104, 123, 262
FalI AAGNNNNNCTT 3 cut(s) 31, 155, 187
FspBI CTAG 2 cut(s) 23, 53
HgaI GACGC 1 cut(s) 142
HinfI GANTC 2 cut(s) 19, 175
HphI GGTGA 1 cut(s) 149
Hpy166II GTNNAC 1 cut(s) 65
Hpy188I TCNGA 1 cut(s) 74
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 1 cut(s) 65
Hpy99I CGWCG 1 cut(s) 158
HpyAV CCTTC 1 cut(s) 245
HpyCH4IV ACGT 1 cut(s) 80
HpyCH4V TGCA 3 cut(s) 111, 128, 260
HpyF3I CTNAG 2 cut(s) 6, 57
HpySE526I ACGT 1 cut(s) 80
LpnPI CCDG 2 cut(s) 120, 157
MaeI CTAG 2 cut(s) 23, 53
MaeII ACGT 1 cut(s) 80
MaeIII GTNAC 1 cut(s) 76
MboII GAAGA 4 cut(s) 26, 29, 178, 217
MluCI AATT 2 cut(s) 94, 112
MlyI GAGTC 1 cut(s) 184
MnlI CCTC 1 cut(s) 124
MseI TTAA 1 cut(s) 84
PfeI GAWTC 1 cut(s) 19
PleI GAGTC 1 cut(s) 183
PpsI GAGTC 1 cut(s) 183
PshAI GACNNNNGTC 1 cut(s) 174
PstNI CAGNNNCTG 1 cut(s) 134
RsaI GTAC 1 cut(s) 247
RsaNI GTAC 1 cut(s) 246
SaqAI TTAA 1 cut(s) 84
SchI GAGTC 1 cut(s) 184
SetI ASST 5 cut(s) 17, 58, 83, 146, 224
SgeI CNNG 9 cut(s) 28, 35, 65, 83, 147, 156, 184, 191, 241
SmlI CTYRAG 1 cut(s) 172
SmoI CTYRAG 1 cut(s) 172
Sse9I AATT 2 cut(s) 94, 112
SsiI CCGC 1 cut(s) 147
SspMI CTAG 2 cut(s) 23, 53
TaiI ACGT 1 cut(s) 83
TaqI TCGA 2 cut(s) 168, 180
TasI AATT 2 cut(s) 94, 112
TatI WGTACW 1 cut(s) 245
TfiI GAWTC 1 cut(s) 19
Tru1I TTAA 1 cut(s) 84
Tru9I TTAA 1 cut(s) 84
TspGWI ACGGA 1 cut(s) 106
XspI CTAG 2 cut(s) 23, 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.