Rmu_sc0013102.1_g000015

serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013102.1
Physical Location & Seq
Forward (+)
56289 .. 56627
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013102.1_g000015.1.cds

Sequence Viewer

Length: 339 bp
atgaccaaaatgctcgagtttcatctcaatttacgaacattgccactgaccattcaatgcccaaacctccacgcgctcgggatcgtctaccgcaagttcaaacctaagaacgtcctcctccgcgaggatgatcacatcatgctctccaacttcaacctccgcaagtcgccaggaattactagaggcctcgaggctttcttgaaaatttcaactgcgttcttgacgctgttctctttcgaggcgtcgatttcctactccgtcggggtttcgacgcacagagacttggatttcggcgacaaaaacccttgcgagatcagatcttggaaaacggcggagtaa

Protein Analysis

112

Amino Acids

12.86

Weight (kDa)

9.3

Isoelectric Point (pI)

22.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025644)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0013102.1_g000015 Rmu_sc0015727.1_g000001
rosa_samantha Rh1CG205200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 188
AccI GTMKAC 1 cut(s) 87
AccII CGCG 2 cut(s) 74, 123
AciI CCGC 4 cut(s) 91, 121, 160, 332
AclWI GGATC 1 cut(s) 89
AcsI RAATTY 1 cut(s) 204
AcyI GRCGYC 1 cut(s) 242
AfiI CCNNNNNNNGG 1 cut(s) 124
AgsI TTSAA 5 cut(s) 56, 100, 154, 202, 210
AjnI CCWGG 1 cut(s) 169
Alw26I GTCTC 1 cut(s) 273
AlwI GGATC 1 cut(s) 89
Ama87I CYCGRG 3 cut(s) 14, 77, 188
AoxI GGCC 1 cut(s) 184
ApoI RAATTY 1 cut(s) 204
ArsI GACNNNNNNTTYG 2 cut(s) 272, 304
AspLEI GCGC 1 cut(s) 76
AvaI CYCGRG 3 cut(s) 14, 77, 188
BciT130I CCWGG 1 cut(s) 171
BclI TGATCA 1 cut(s) 130
BcoDI GTCTC 1 cut(s) 273
BfaI CTAG 1 cut(s) 180
BglII AGATCT 1 cut(s) 317
Bme1390I CCNGG 1 cut(s) 171
BmeT110I CYCGRG 3 cut(s) 14, 77, 188
BmrFI CCNGG 1 cut(s) 171
BsaHI GRCGYC 1 cut(s) 242
Bsc4I CCNNNNNNNGG 1 cut(s) 124
Bse3DI GCAATG 1 cut(s) 38
BseBI CCWGG 1 cut(s) 171
BseGI GGATG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 124
BseMI GCAATG 1 cut(s) 38
BseRI GAGGAG 1 cut(s) 107
Bsh1236I CGCG 2 cut(s) 74, 123
BshFI GGCC 1 cut(s) 186
BsiHKCI CYCGRG 3 cut(s) 14, 77, 188
BslI CCNNNNNNNGG 1 cut(s) 124
BsmAI GTCTC 1 cut(s) 273
BsnI GGCC 1 cut(s) 186
BsoBI CYCGRG 3 cut(s) 14, 77, 188
Bsp143I GATC 4 cut(s) 81, 130, 312, 317
BspACI CCGC 4 cut(s) 91, 121, 160, 332
BspANI GGCC 1 cut(s) 186
BspFNI CGCG 2 cut(s) 74, 123
BspPI GGATC 1 cut(s) 89
BsrDI GCAATG 1 cut(s) 38
BssMI GATC 4 cut(s) 81, 130, 312, 317
BssNI GRCGYC 1 cut(s) 242
Bst2UI CCWGG 1 cut(s) 171
BstACI GRCGYC 1 cut(s) 242
BstDEI CTNAG 1 cut(s) 105
BstENI CCTNNNNNAGG 1 cut(s) 122
BstF5I GGATG 1 cut(s) 133
BstFNI CGCG 2 cut(s) 74, 123
BstHHI GCGC 1 cut(s) 76
BstKTI GATC 4 cut(s) 84, 133, 315, 320
BstMAI GTCTC 1 cut(s) 273
BstMBI GATC 4 cut(s) 81, 130, 312, 317
BstNI CCWGG 1 cut(s) 171
BstSCI CCNGG 1 cut(s) 169
BstUI CGCG 2 cut(s) 74, 123
BstX2I RGATCY 1 cut(s) 317
BstYI RGATCY 1 cut(s) 317
BsuRI GGCC 1 cut(s) 186
BtsCI GGATG 1 cut(s) 133
BtsIMutI CAGTG 1 cut(s) 44
CfoI GCGC 1 cut(s) 76
CseI GACGC 3 cut(s) 231, 232, 280
CviAII CATG 1 cut(s) 139
CviJI RGCY 2 cut(s) 186, 194
CviKI_1 RGCY 2 cut(s) 186, 194
DdeI CTNAG 1 cut(s) 105
DpnI GATC 4 cut(s) 83, 132, 314, 319
DpnII GATC 4 cut(s) 81, 130, 312, 317
Eco147I AGGCCT 1 cut(s) 186
Eco88I CYCGRG 3 cut(s) 14, 77, 188
EcoNI CCTNNNNNAGG 1 cut(s) 122
EcoRII CCWGG 1 cut(s) 169
FaeI CATG 1 cut(s) 142
FaiI YATR 1 cut(s) 140
FatI CATG 1 cut(s) 138
FbaI TGATCA 1 cut(s) 130
FblI GTMKAC 1 cut(s) 87
FokI GGATG 1 cut(s) 140
FspBI CTAG 1 cut(s) 180
GlaI GCGC 1 cut(s) 75
HaeIII GGCC 1 cut(s) 186
HgaI GACGC 3 cut(s) 231, 232, 280
HhaI GCGC 1 cut(s) 76
Hin1I GRCGYC 1 cut(s) 242
Hin1II CATG 1 cut(s) 142
Hin6I GCGC 1 cut(s) 74
HinP1I GCGC 1 cut(s) 74
Hpy166II GTNNAC 1 cut(s) 88
Hpy188I TCNGA 1 cut(s) 317
Hpy188III TCNNGA 3 cut(s) 79, 199, 220
Hpy8I GTNNAC 1 cut(s) 88
Hpy99I CGWCG 3 cut(s) 247, 263, 274
HpyCH4IV ACGT 1 cut(s) 111
HpyF3I CTNAG 1 cut(s) 105
HpySE526I ACGT 1 cut(s) 111
Hsp92I GRCGYC 1 cut(s) 242
Hsp92II CATG 1 cut(s) 142
HspAI GCGC 1 cut(s) 74
Ksp22I TGATCA 1 cut(s) 130
Kzo9I GATC 4 cut(s) 81, 130, 312, 317
LpnPI CCDG 2 cut(s) 156, 183
MaeI CTAG 1 cut(s) 180
MaeII ACGT 1 cut(s) 111
MalI GATC 4 cut(s) 83, 132, 314, 319
MboI GATC 4 cut(s) 81, 130, 312, 317
MflI RGATCY 1 cut(s) 317
MluCI AATT 3 cut(s) 28, 174, 204
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 9 cut(s) 77, 118, 125, 128, 167, 176, 184, 197, 232
MspR9I CCNGG 1 cut(s) 171
MvaI CCWGG 1 cut(s) 171
MvnI CGCG 2 cut(s) 74, 123
NdeII GATC 4 cut(s) 81, 130, 312, 317
NlaIII CATG 1 cut(s) 142
PaeR7I CTCGAG 2 cut(s) 14, 188
PceI AGGCCT 1 cut(s) 186
Psp6I CCWGG 1 cut(s) 169
PspGI CCWGG 1 cut(s) 169
PspXI VCTCGAGB 2 cut(s) 14, 188
PsuI RGATCY 1 cut(s) 317
Sau3AI GATC 4 cut(s) 81, 130, 312, 317
ScrFI CCNGG 1 cut(s) 171
SetI ASST 4 cut(s) 69, 106, 114, 159
Sfr274I CTCGAG 2 cut(s) 14, 188
SlaI CTCGAG 2 cut(s) 14, 188
SmlI CTYRAG 2 cut(s) 14, 188
SmoI CTYRAG 2 cut(s) 14, 188
Sse9I AATT 3 cut(s) 28, 174, 204
SseBI AGGCCT 1 cut(s) 186
SsiI CCGC 4 cut(s) 91, 121, 160, 332
SspMI CTAG 1 cut(s) 180
StuI AGGCCT 1 cut(s) 186
StyD4I CCNGG 1 cut(s) 169
TaiI ACGT 1 cut(s) 114
TaqI TCGA 5 cut(s) 15, 189, 237, 245, 269
TasI AATT 3 cut(s) 28, 174, 204
TscAI CASTG 1 cut(s) 51
TspDTI ATGAA 1 cut(s) 11
TspGWI ACGGA 1 cut(s) 247
TspRI CASTG 1 cut(s) 51
XagI CCTNNNNNAGG 1 cut(s) 122
XapI RAATTY 1 cut(s) 204
XhoI CTCGAG 2 cut(s) 14, 188
XmiI GTMKAC 1 cut(s) 87
XspI CTAG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.