Rmu_sc0023554.1_g000001
NAC Family

inactive receptor kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0023554.1
Physical Location & Seq
Forward (+)
1 .. 1210
1210 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0023554.1_g000001.1.cds

Sequence Viewer

Length: 392 bp
ttgaacccaaaaacccgtcgcttcttcttgatggcagtgggtttggtagtggcgggtgtagggaaagcttgcctcttgggacttcaagaaagcctcagtgggtttcatctgccactttgtggtttgcagaatctagatctacaggtaatgatctttttggagtgatccctaatgatctgtgtgcttggttgtcgtatatggttactttggatttgtccaggaacaaattcacgggtccaatcccagctgatttgcagaagtgtactttcttgaacggtctgatcctttcggataataagcttacgggtagtattccttatgagttttctagctttactaggctgaagaagttttctgtggcgaataatcagttgagtgggactataccatag

Protein Analysis

129

Amino Acids

14.01

Weight (kDa)

8.56

Isoelectric Point (pI)

39.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0023143)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0023554.1_g000001 Rmu_sc0039115.1_g000001
rosa_roxburghii Rroxscaffold_2G00155010
rosa_samantha Rh2AG012700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 119
AciI CCGC 1 cut(s) 53
AclWI GGATC 2 cut(s) 159, 276
AcsI RAATTY 1 cut(s) 226
AcuI CTGAAG 1 cut(s) 364
AdeI CACNNNGTG 1 cut(s) 119
AfaI GTAC 1 cut(s) 264
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 3 cut(s) 4, 86, 273
AjnI CCWGG 1 cut(s) 217
AluBI AGCT 4 cut(s) 68, 247, 300, 332
AluI AGCT 4 cut(s) 68, 247, 300, 332
AlwI GGATC 2 cut(s) 159, 276
ApoI RAATTY 1 cut(s) 226
Asp700I GAANNNNTTC 1 cut(s) 226
AspS9I GGNCC 1 cut(s) 235
AvaII GGWCC 1 cut(s) 235
BccI CCATC 1 cut(s) 25
BciT130I CCWGG 1 cut(s) 219
BfaI CTAG 3 cut(s) 134, 329, 338
BfmI CTRYAG 1 cut(s) 140
BglII AGATCT 1 cut(s) 136
Bme1390I CCNGG 1 cut(s) 219
Bme18I GGWCC 1 cut(s) 235
BmgT120I GGNCC 1 cut(s) 235
BmiI GGNNCC 1 cut(s) 236
BmrFI CCNGG 1 cut(s) 219
Bsc4I CCNNNNNNNGG 1 cut(s) 119
BseBI CCWGG 1 cut(s) 219
BseLI CCNNNNNNNGG 1 cut(s) 119
BseMII CTCAG 1 cut(s) 109
BseYI CCCAGC 1 cut(s) 243
BslFI GGGAC 1 cut(s) 93
BslI CCNNNNNNNGG 1 cut(s) 119
BsmFI GGGAC 1 cut(s) 93
Bsp143I GATC 5 cut(s) 136, 150, 164, 174, 281
BspACI CCGC 1 cut(s) 53
BspCNI CTCAG 1 cut(s) 108
BspLI GGNNCC 1 cut(s) 236
BspPI GGATC 2 cut(s) 159, 276
BssMI GATC 5 cut(s) 136, 150, 164, 174, 281
Bst2UI CCWGG 1 cut(s) 219
Bst4CI ACNGT 1 cut(s) 277
BstC8I GCNNGC 1 cut(s) 70
BstDEI CTNAG 1 cut(s) 95
BstKTI GATC 5 cut(s) 139, 153, 167, 177, 284
BstMBI GATC 5 cut(s) 136, 150, 164, 174, 281
BstNI CCWGG 1 cut(s) 219
BstSCI CCNGG 1 cut(s) 217
BstSFI CTRYAG 1 cut(s) 140
BstX2I RGATCY 1 cut(s) 136
BstYI RGATCY 1 cut(s) 136
BtsI GCAGTG 1 cut(s) 42
BtsIMutI CAGTG 2 cut(s) 42, 103
Cac8I GCNNGC 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 235
Csp6I GTAC 1 cut(s) 263
CviJI RGCY 6 cut(s) 68, 93, 247, 300, 332, 342
CviKI_1 RGCY 6 cut(s) 68, 93, 247, 300, 332, 342
CviQI GTAC 1 cut(s) 263
DdeI CTNAG 1 cut(s) 95
DpnI GATC 5 cut(s) 138, 152, 166, 176, 283
DpnII GATC 5 cut(s) 136, 150, 164, 174, 281
DraIII CACNNNGTG 1 cut(s) 119
Eco47I GGWCC 1 cut(s) 235
Eco57I CTGAAG 1 cut(s) 364
EcoRII CCWGG 1 cut(s) 217
FaiI YATR 5 cut(s) 197, 199, 320, 385, 390
FaqI GGGAC 1 cut(s) 93
FauI CCCGC 1 cut(s) 46
FspBI CTAG 3 cut(s) 134, 329, 338
GsaI CCCAGC 1 cut(s) 247
HindIII AAGCTT 2 cut(s) 66, 298
HinfI GANTC 1 cut(s) 130
Hpy166II GTNNAC 1 cut(s) 263
Hpy188I TCNGA 2 cut(s) 281, 291
Hpy188III TCNNGA 4 cut(s) 28, 86, 134, 270
Hpy8I GTNNAC 1 cut(s) 263
Hpy99I CGWCG 1 cut(s) 21
HpyCH4III ACNGT 1 cut(s) 277
HpyCH4V TGCA 2 cut(s) 127, 255
HpyF3I CTNAG 1 cut(s) 95
Kzo9I GATC 5 cut(s) 136, 150, 164, 174, 281
LpnPI CCDG 4 cut(s) 128, 204, 231, 257
MaeI CTAG 3 cut(s) 134, 329, 338
MaeIII GTNAC 1 cut(s) 201
MalI GATC 5 cut(s) 138, 152, 166, 176, 283
MboI GATC 5 cut(s) 136, 150, 164, 174, 281
MboII GAAGA 2 cut(s) 16, 357
MflI RGATCY 1 cut(s) 136
MluCI AATT 1 cut(s) 226
MnlI CCTC 2 cut(s) 83, 104
MroXI GAANNNNTTC 1 cut(s) 226
MspA1I CMGCKG 1 cut(s) 247
MspR9I CCNGG 1 cut(s) 219
MvaI CCWGG 1 cut(s) 219
NdeII GATC 5 cut(s) 136, 150, 164, 174, 281
NlaIV GGNNCC 1 cut(s) 236
PdmI GAANNNNTTC 1 cut(s) 226
PfeI GAWTC 1 cut(s) 130
PflMI CCANNNNNTGG 1 cut(s) 119
PfoI TCCNGGA 1 cut(s) 217
Psp6I CCWGG 1 cut(s) 217
PspFI CCCAGC 1 cut(s) 243
PspGI CCWGG 1 cut(s) 217
PspN4I GGNNCC 1 cut(s) 236
PspPI GGNCC 1 cut(s) 235
PsuI RGATCY 1 cut(s) 136
PvuII CAGCTG 1 cut(s) 247
RsaI GTAC 1 cut(s) 264
RsaNI GTAC 1 cut(s) 263
Sau3AI GATC 5 cut(s) 136, 150, 164, 174, 281
Sau96I GGNCC 1 cut(s) 235
ScrFI CCNGG 1 cut(s) 219
SetI ASST 5 cut(s) 70, 147, 249, 302, 334
SfcI CTRYAG 1 cut(s) 140
SinI GGWCC 1 cut(s) 235
Sse9I AATT 1 cut(s) 226
SsiI CCGC 1 cut(s) 53
SspMI CTAG 3 cut(s) 134, 329, 338
StyD4I CCNGG 1 cut(s) 217
TaaI ACNGT 1 cut(s) 277
TasI AATT 1 cut(s) 226
TatI WGTACW 1 cut(s) 262
TfiI GAWTC 1 cut(s) 130
TscAI CASTG 2 cut(s) 42, 103
TspDTI ATGAA 1 cut(s) 95
TspRI CASTG 2 cut(s) 42, 103
Van91I CCANNNNNTGG 1 cut(s) 119
VpaK11BI GGWCC 1 cut(s) 235
XapI RAATTY 1 cut(s) 226
XbaI TCTAGA 1 cut(s) 133
XmnI GAANNNNTTC 1 cut(s) 226
XspI CTAG 3 cut(s) 134, 329, 338
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.