Rmu_sc0039102.1_g000001

mediator of RNA polymerase II transcription subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0039102.1
OG0018960
Physical Location & Seq
Reverse (-)
106 .. 654
549 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0039102.1_g000001.1.cds

Sequence Viewer

Length: 549 bp
atgctcgagtctctgacgagactaaagatgatgactatgactgtggagactcttgaggcaacggcaattggtaaagttgttagtggtctcaaaaagcatggatccaagcagattagtgatcttgctcgaacacttgttgatgggtggaaagtcgtggtaagtgaatatttggctacccaaaattcgaaacagtcctcttcagatgttcttagcaaacagaacaagaatgaacaactagtgatcaagaaacaagaagttgtagctgtgaagccaattaaggcctcaaacaacaatgaagaaaagatgccgcgcttggatgatgaagttgcagcgcaagcgaaaatcgaagccacaaaaaggaaactccatgagcgttatgagcaaattgagaacaccaagaagcaaaggatggttcaagtcttggatgatctccccaagcaagggcctaaagttggctcccacactactaatctacatggaaagaaacctggttcagcacatggacggatatccagattaaaaaagcaagctggtgtggtcggcaagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Med26

Protein Analysis

182

Amino Acids

20.2

Weight (kDa)

9.93

Isoelectric Point (pI)

32.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018960)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0352691
rosa_laevigata RLG00000028320
rosa_multiflora Rmu_sc0039102.1_g000001 Rmu_sc0039103.1_g000001
rosa_roxburghii Rroxscaffold_4G00302470
rosa_rugosa Rorug01G0231000
rosa_samantha Rh1AG244100 Rh1BG214800 Rh1CG228100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 310
AciI CCGC 1 cut(s) 308
AclWI GGATC 2 cut(s) 96, 109
AcsI RAATTY 1 cut(s) 181
AcuI CTGAAG 1 cut(s) 183
AfiI CCNNNNNNNGG 4 cut(s) 357, 440, 441, 452
AgsI TTSAA 1 cut(s) 416
AhlI ACTAGT 1 cut(s) 235
AjnI CCWGG 1 cut(s) 487
AluBI AGCT 2 cut(s) 263, 530
AluI AGCT 2 cut(s) 263, 530
Alw26I GTCTC 4 cut(s) 13, 15, 41, 92
AlwI GGATC 2 cut(s) 96, 109
Ama87I CYCGRG 1 cut(s) 5
AoxI GGCC 2 cut(s) 279, 443
ApeKI GCWGC 1 cut(s) 329
ApoI RAATTY 1 cut(s) 181
AspLEI GCGC 2 cut(s) 312, 334
AspS9I GGNCC 1 cut(s) 443
AsuII TTCGAA 1 cut(s) 185
AvaI CYCGRG 1 cut(s) 5
BamHI GGATCC 1 cut(s) 101
BbvI GCAGC 1 cut(s) 341
BccI CCATC 2 cut(s) 134, 403
BceAI ACGGC 1 cut(s) 78
BciT130I CCWGG 1 cut(s) 489
BclI TGATCA 1 cut(s) 240
BcoDI GTCTC 4 cut(s) 13, 15, 41, 92
BcuI ACTAGT 1 cut(s) 235
BfaI CTAG 1 cut(s) 236
BisI GCNGC 2 cut(s) 308, 330
BlsI GCNGC 2 cut(s) 309, 331
Bme1390I CCNGG 1 cut(s) 489
BmeT110I CYCGRG 1 cut(s) 5
BmgT120I GGNCC 1 cut(s) 443
BmiI GGNNCC 2 cut(s) 103, 457
BmrFI CCNGG 1 cut(s) 489
BmsI GCATC 1 cut(s) 294
Bpu14I TTCGAA 1 cut(s) 185
BpuEI CTTGAG 1 cut(s) 74
BsaI GGTCTC 1 cut(s) 92
Bsc4I CCNNNNNNNGG 4 cut(s) 357, 440, 441, 452
BseBI CCWGG 1 cut(s) 489
BseGI GGATG 3 cut(s) 322, 414, 430
BseLI CCNNNNNNNGG 4 cut(s) 357, 440, 441, 452
BseXI GCAGC 1 cut(s) 341
Bsh1236I CGCG 1 cut(s) 310
BshFI GGCC 2 cut(s) 281, 445
BsiHKCI CYCGRG 1 cut(s) 5
BslI CCNNNNNNNGG 4 cut(s) 357, 440, 441, 452
BsmAI GTCTC 4 cut(s) 13, 15, 41, 92
BsnI GGCC 2 cut(s) 281, 445
Bso31I GGTCTC 1 cut(s) 92
BsoBI CYCGRG 1 cut(s) 5
Bsp119I TTCGAA 1 cut(s) 185
Bsp143I GATC 4 cut(s) 101, 118, 240, 427
BspACI CCGC 1 cut(s) 308
BspANI GGCC 2 cut(s) 281, 445
BspFNI CGCG 1 cut(s) 310
BspLI GGNNCC 2 cut(s) 103, 457
BspPI GGATC 2 cut(s) 96, 109
BspT104I TTCGAA 1 cut(s) 185
BspTNI GGTCTC 1 cut(s) 92
BssMI GATC 4 cut(s) 101, 118, 240, 427
Bst2UI CCWGG 1 cut(s) 489
Bst4CI ACNGT 2 cut(s) 43, 192
Bst6I CTCTTC 1 cut(s) 202
BstBI TTCGAA 1 cut(s) 185
BstC8I GCNNGC 2 cut(s) 336, 528
BstDEI CTNAG 1 cut(s) 209
BstF5I GGATG 3 cut(s) 322, 414, 430
BstFNI CGCG 1 cut(s) 310
BstHHI GCGC 2 cut(s) 312, 334
BstKTI GATC 4 cut(s) 104, 121, 243, 430
BstMAI GTCTC 4 cut(s) 13, 15, 41, 92
BstMBI GATC 4 cut(s) 101, 118, 240, 427
BstMWI GCNNNNNNNGC 2 cut(s) 335, 379
BstNI CCWGG 1 cut(s) 489
BstSCI CCNGG 1 cut(s) 487
BstUI CGCG 1 cut(s) 310
BstV1I GCAGC 1 cut(s) 341
BstX2I RGATCY 1 cut(s) 101
BstYI RGATCY 1 cut(s) 101
BsuRI GGCC 2 cut(s) 281, 445
BtsCI GGATG 3 cut(s) 322, 414, 430
Cac8I GCNNGC 2 cut(s) 336, 528
CfoI GCGC 2 cut(s) 312, 334
Cfr13I GGNCC 1 cut(s) 443
CsiI ACCWGGT 1 cut(s) 487
CviAII CATG 4 cut(s) 98, 368, 476, 500
CviJI RGCY 8 cut(s) 173, 263, 271, 281, 350, 445, 456, 530
CviKI_1 RGCY 8 cut(s) 173, 263, 271, 281, 350, 445, 456, 530
DdeI CTNAG 1 cut(s) 209
DpnI GATC 4 cut(s) 103, 120, 242, 429
DpnII GATC 4 cut(s) 101, 118, 240, 427
Eam1104I CTCTTC 1 cut(s) 202
EarI CTCTTC 1 cut(s) 202
Eco147I AGGCCT 1 cut(s) 281
Eco31I GGTCTC 1 cut(s) 92
Eco32I GATATC 1 cut(s) 510
Eco57I CTGAAG 1 cut(s) 183
Eco88I CYCGRG 1 cut(s) 5
EcoO109I RGGNCCY 1 cut(s) 443
EcoRII CCWGG 1 cut(s) 487
EcoRV GATATC 1 cut(s) 510
FaeI CATG 4 cut(s) 101, 371, 479, 503
FaiI YATR 6 cut(s) 38, 99, 369, 378, 477, 501
FatI CATG 4 cut(s) 97, 367, 475, 499
FbaI TGATCA 1 cut(s) 240
Fnu4HI GCNGC 2 cut(s) 308, 330
FokI GGATG 3 cut(s) 329, 421, 437
Fsp4HI GCNGC 2 cut(s) 308, 330
FspBI CTAG 1 cut(s) 236
GlaI GCGC 2 cut(s) 311, 333
GluI GCNGC 2 cut(s) 308, 330
HaeIII GGCC 2 cut(s) 281, 445
HhaI GCGC 2 cut(s) 312, 334
Hin1II CATG 4 cut(s) 101, 371, 479, 503
Hin6I GCGC 2 cut(s) 310, 332
HinP1I GCGC 2 cut(s) 310, 332
HinfI GANTC 2 cut(s) 8, 49
Hpy188I TCNGA 2 cut(s) 15, 202
Hpy188III TCNNGA 3 cut(s) 53, 244, 513
HpyCH4III ACNGT 2 cut(s) 43, 192
HpyCH4V TGCA 1 cut(s) 329
HpyF10VI GCNNNNNNNGC 2 cut(s) 335, 379
HpyF3I CTNAG 1 cut(s) 209
Hsp92II CATG 4 cut(s) 101, 371, 479, 503
HspAI GCGC 2 cut(s) 310, 332
Ksp22I TGATCA 1 cut(s) 240
Kzo9I GATC 4 cut(s) 101, 118, 240, 427
LmnI GCTCC 1 cut(s) 461
LpnPI CCDG 4 cut(s) 474, 501, 516, 526
Lsp1109I GCAGC 1 cut(s) 341
LweI GCATC 1 cut(s) 294
MabI ACCWGGT 1 cut(s) 487
MaeI CTAG 1 cut(s) 236
MalI GATC 4 cut(s) 103, 120, 242, 429
MboI GATC 4 cut(s) 101, 118, 240, 427
MboII GAAGA 2 cut(s) 189, 308
MfeI CAATTG 1 cut(s) 66
MflI RGATCY 1 cut(s) 101
MluCI AATT 4 cut(s) 66, 181, 273, 384
MlyI GAGTC 2 cut(s) 17, 43
MnlI CCTC 3 cut(s) 49, 205, 292
MseI TTAA 2 cut(s) 276, 518
MspR9I CCNGG 1 cut(s) 489
MunI CAATTG 1 cut(s) 66
MvaI CCWGG 1 cut(s) 489
MvnI CGCG 1 cut(s) 310
MwoI GCNNNNNNNGC 2 cut(s) 335, 379
NdeII GATC 4 cut(s) 101, 118, 240, 427
NlaIII CATG 4 cut(s) 101, 371, 479, 503
NlaIV GGNNCC 2 cut(s) 103, 457
NspV TTCGAA 1 cut(s) 185
PaeR7I CTCGAG 1 cut(s) 5
PceI AGGCCT 1 cut(s) 281
PkrI GCNGC 2 cut(s) 309, 331
PleI GAGTC 2 cut(s) 16, 43
PpsI GAGTC 2 cut(s) 16, 43
Psp6I CCWGG 1 cut(s) 487
PspGI CCWGG 1 cut(s) 487
PspN4I GGNNCC 2 cut(s) 103, 457
PspPI GGNCC 1 cut(s) 443
PspXI VCTCGAGB 1 cut(s) 5
PsuI RGATCY 1 cut(s) 101
SaqAI TTAA 2 cut(s) 276, 518
SatI GCNGC 2 cut(s) 308, 330
Sau3AI GATC 4 cut(s) 101, 118, 240, 427
Sau96I GGNCC 1 cut(s) 443
SchI GAGTC 2 cut(s) 17, 43
ScrFI CCNGG 1 cut(s) 489
SetI ASST 3 cut(s) 265, 490, 532
SexAI ACCWGGT 1 cut(s) 487
SfaNI GCATC 1 cut(s) 294
Sfr274I CTCGAG 1 cut(s) 5
SfuI TTCGAA 1 cut(s) 185
SlaI CTCGAG 1 cut(s) 5
SmlI CTYRAG 2 cut(s) 5, 53
SmoI CTYRAG 2 cut(s) 5, 53
SpeI ACTAGT 1 cut(s) 235
Sse9I AATT 4 cut(s) 66, 181, 273, 384
SseBI AGGCCT 1 cut(s) 281
SsiI CCGC 1 cut(s) 308
SspI AATATT 1 cut(s) 167
SspMI CTAG 1 cut(s) 236
StuI AGGCCT 1 cut(s) 281
StyD4I CCNGG 1 cut(s) 487
TaaI ACNGT 2 cut(s) 43, 192
TaqI TCGA 4 cut(s) 6, 127, 185, 345
TasI AATT 4 cut(s) 66, 181, 273, 384
TauI GCSGC 1 cut(s) 310
Tru1I TTAA 2 cut(s) 276, 518
Tru9I TTAA 2 cut(s) 276, 518
TseI GCWGC 1 cut(s) 329
TspDTI ATGAA 3 cut(s) 243, 309, 336
TspGWI ACGGA 1 cut(s) 520
XapI RAATTY 1 cut(s) 181
XhoI CTCGAG 1 cut(s) 5
XspI CTAG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.