Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000087.1

Orthogroup ID

OG0025449

Physical Location & Seq

Genomic Coordinates Forward (+)

67498 .. 68313

Gene Structure 816 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000087.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 669 bp

atgggttttctccctgcagccaatggtcttttggtactttacattaccatcattctctttcagctgtactatggggatgactgggaaggcatttttgaggcaaatactggctatggtcttggtgaatcagcaatacctcttttcggaagagtaggtggtggtatctatgccagggctgctgatgttagtgccgaccttgttaaaaaatttgaaagaaacattcctgctgatgacccaagaaacccagttgtgattgctgacaatgttgccatgttgctcctcaagaatttgtcacgcaaaaagttgcaccgatctgtgaagcctccaatattttcatgctttggtgatctagctttggccattggggaaattttggaaaaatttttgctgtatgccatgcccatgcttcagagtgtggcagaactatcagttcagacatcaggtgctgatgatgacatgacagagtacacatactttgaggaacttggagtcataaagtacaaacactctatgtctgcaataggaagtgcaatgggtcctagttctgaaggctatgaagcagaagttgcagatgggatgattaaagcaatgaaagggcatggaatggtttctgctgtgctgattgctgaagaattctgggctcatttcccttgtctcttacatatttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000325 GO:0001101 GO:0003674 GO:0003824 GO:0005215 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005768 GO:0005773 GO:0005774 GO:0005794 GO:0005886 GO:0006810 GO:0006811 GO:0006950 GO:0006970 GO:0007275 GO:0008150 GO:0009414 GO:0009415 GO:0009507 GO:0009526 GO:0009536 GO:0009628 GO:0009651 GO:0009678 GO:0009705 GO:0009914 GO:0009926 GO:0009941 GO:0010008 GO:0010035 GO:0010248 GO:0010817 GO:0012505 GO:0015399 GO:0015405 GO:0016020 GO:0016462 GO:0016787 GO:0016817 GO:0016818 GO:0022804 GO:0022857 GO:0031090 GO:0031410 GO:0031967 GO:0031975 GO:0031982 GO:0032501 GO:0032502 GO:0034220 GO:0042221 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044433 GO:0044434 GO:0044435 GO:0044437 GO:0044440 GO:0044444 GO:0044446 GO:0044464 GO:0048366 GO:0048367 GO:0048731 GO:0048827 GO:0048856 GO:0050896 GO:0051179 GO:0051234 GO:0055085 GO:0060918 GO:0065007 GO:0065008 GO:0071944 GO:0097708 GO:0098588 GO:0098805 GO:0099402 GO:1901700

KEGG Pathways

Metabolic & Signaling

ko00190 map00190

Pfam Domains

Protein Families

H_PPase

Protein Analysis

222

Amino Acids

24.21

Weight (kDa)

4.91

Isoelectric Point (pI)

32.26

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025449)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_ssc0000087.1_g000011 Rmu_ssc0000087.1_g000019
rosa_samantha	Rh6CG021200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	357
AcsI	RAATTY	5 cut(s)	206, 286, 369, 380, 632
AcuI	CTGAAG	3 cut(s)	392, 567, 648
AfaI	GTAC	4 cut(s)	36, 68, 467, 500
AfiI	CCNNNNNNNGG	1 cut(s)	143
AgsI	TTSAA	1 cut(s)	212
AjnI	CCWGG	1 cut(s)	170
AluBI	AGCT	2 cut(s)	64, 353
AluI	AGCT	2 cut(s)	64, 353
Alw26I	GTCTC	1 cut(s)	659
AlwNI	CAGNNNCTG	1 cut(s)	446
AoxI	GGCC	1 cut(s)	357
ApeKI	GCWGC	2 cut(s)	17, 176
ApoI	RAATTY	5 cut(s)	206, 286, 369, 380, 632
Asp700I	GAANNNNTTC	1 cut(s)	607
AspS9I	GGNCC	1 cut(s)	536
AsuHPI	GGTGA	2 cut(s)	134, 356
AvaII	GGWCC	1 cut(s)	536
BalI	TGGCCA	1 cut(s)	359
BanII	GRGCYC	1 cut(s)	643
BbvI	GCAGC	2 cut(s)	29, 163
BccI	CCATC	2 cut(s)	56, 566
BciT130I	CCWGG	1 cut(s)	172
BcoDI	GTCTC	1 cut(s)	659
BfaI	CTAG	2 cut(s)	350, 540
BfmI	CTRYAG	1 cut(s)	15
BisI	GCNGC	2 cut(s)	18, 177
BlsI	GCNGC	2 cut(s)	19, 178
Bme1390I	CCNGG	1 cut(s)	172
Bme18I	GGWCC	1 cut(s)	536
BmgT120I	GGNCC	1 cut(s)	536
BmiI	GGNNCC	1 cut(s)	537
BmrFI	CCNGG	1 cut(s)	172
BmrI	ACTGGG	2 cut(s)	91, 239
BmuI	ACTGGG	2 cut(s)	91, 239
BpuEI	CTTGAG	1 cut(s)	266
BsaJI	CCNNGG	1 cut(s)	171
Bsc4I	CCNNNNNNNGG	1 cut(s)	143
Bse1I	ACTGG	3 cut(s)	86, 112, 245
Bse3DI	GCAATG	2 cut(s)	537, 594
BseBI	CCWGG	1 cut(s)	172
BseDI	CCNNGG	1 cut(s)	171
BseGI	GGATG	2 cut(s)	82, 582
BseLI	CCNNNNNNNGG	1 cut(s)	143
BseMI	GCAATG	2 cut(s)	537, 594
BseNI	ACTGG	3 cut(s)	86, 112, 245
BseRI	GAGGAG	1 cut(s)	269
BseXI	GCAGC	2 cut(s)	29, 163
BshFI	GGCC	1 cut(s)	359
BslI	CCNNNNNNNGG	1 cut(s)	143
BsmAI	GTCTC	1 cut(s)	659
BsnI	GGCC	1 cut(s)	359
Bsp1286I	GDGCHC	1 cut(s)	643
Bsp143I	GATC	2 cut(s)	311, 346
BspANI	GGCC	1 cut(s)	359
BspLI	GGNNCC	1 cut(s)	537
BspMAI	CTGCAG	1 cut(s)	19
BsrDI	GCAATG	2 cut(s)	537, 594
BsrI	ACTGG	3 cut(s)	86, 112, 245
BssECI	CCNNGG	1 cut(s)	171
BssMI	GATC	2 cut(s)	311, 346
Bst2UI	CCWGG	1 cut(s)	172
Bst6I	CTCTTC	1 cut(s)	142
BstAPI	GCANNNNNTGC	1 cut(s)	566
BstF5I	GGATG	2 cut(s)	82, 582
BstKTI	GATC	2 cut(s)	314, 349
BstMAI	GTCTC	1 cut(s)	659
BstMBI	GATC	2 cut(s)	311, 346
BstMWI	GCNNNNNNNGC	2 cut(s)	176, 566
BstNI	CCWGG	1 cut(s)	172
BstSCI	CCNGG	1 cut(s)	170
BstSFI	CTRYAG	1 cut(s)	15
BstV1I	GCAGC	2 cut(s)	29, 163
BsuRI	GGCC	1 cut(s)	359
BtsCI	GGATG	2 cut(s)	82, 582
CaiI	CAGNNNCTG	1 cut(s)	446
Cfr13I	GGNCC	1 cut(s)	536
Csp6I	GTAC	4 cut(s)	35, 67, 466, 499
CviAII	CATG	6 cut(s)	271, 336, 397, 403, 457, 599
CviJI	RGCY	9 cut(s)	20, 64, 111, 176, 322, 353, 359, 552, 641
CviKI_1	RGCY	9 cut(s)	20, 64, 111, 176, 322, 353, 359, 552, 641
CviQI	GTAC	4 cut(s)	35, 67, 466, 499
DpnI	GATC	2 cut(s)	313, 348
DpnII	GATC	2 cut(s)	311, 346
EaeI	YGGCCR	1 cut(s)	357
Eam1104I	CTCTTC	1 cut(s)	142
EarI	CTCTTC	1 cut(s)	142
Eco24I	GRGCYC	1 cut(s)	643
Eco47I	GGWCC	1 cut(s)	536
Eco57I	CTGAAG	3 cut(s)	392, 567, 648
EcoO109I	RGGNCCY	1 cut(s)	536
EcoRI	GAATTC	1 cut(s)	632
EcoRII	CCWGG	1 cut(s)	170
EcoT38I	GRGCYC	1 cut(s)	643
FaeI	CATG	6 cut(s)	274, 339, 400, 406, 460, 602
FatI	CATG	6 cut(s)	270, 335, 396, 402, 456, 598
Fnu4HI	GCNGC	2 cut(s)	18, 177
FokI	GGATG	2 cut(s)	89, 589
FriOI	GRGCYC	1 cut(s)	643
Fsp4HI	GCNGC	2 cut(s)	18, 177
FspBI	CTAG	2 cut(s)	350, 540
GluI	GCNGC	2 cut(s)	18, 177
HaeIII	GGCC	1 cut(s)	359
Hin1II	CATG	6 cut(s)	274, 339, 400, 406, 460, 602
HinfI	GANTC	2 cut(s)	125, 489
HphI	GGTGA	2 cut(s)	134, 356
Hpy166II	GTNNAC	1 cut(s)	468
Hpy188I	TCNGA	4 cut(s)	146, 411, 435, 547
Hpy188III	TCNNGA	1 cut(s)	283
Hpy8I	GTNNAC	1 cut(s)	468
HpyAV	CCTTC	2 cut(s)	80, 542
HpyCH4V	TGCA	5 cut(s)	17, 307, 518, 530, 569
HpyF10VI	GCNNNNNNNGC	2 cut(s)	176, 566
Hsp92II	CATG	6 cut(s)	274, 339, 400, 406, 460, 602
Kzo9I	GATC	2 cut(s)	311, 346
LmnI	GCTCC	1 cut(s)	282
LpnPI	CCDG	9 cut(s)	27, 67, 93, 157, 184, 237, 258, 426, 622
Lsp1109I	GCAGC	2 cut(s)	29, 163
MaeI	CTAG	2 cut(s)	350, 540
MaeIII	GTNAC	1 cut(s)	291
MalI	GATC	2 cut(s)	313, 348
MboI	GATC	2 cut(s)	311, 346
MboII	GAAGA	2 cut(s)	159, 641
MhlI	GDGCHC	1 cut(s)	643
MlsI	TGGCCA	1 cut(s)	359
MluCI	AATT	5 cut(s)	206, 286, 369, 380, 632
MluNI	TGGCCA	1 cut(s)	359
MlyI	GAGTC	1 cut(s)	498
MnlI	CCTC	5 cut(s)	91, 147, 290, 333, 472
Mox20I	TGGCCA	1 cut(s)	359
MroXI	GAANNNNTTC	1 cut(s)	607
MscI	TGGCCA	1 cut(s)	359
MseI	TTAA	3 cut(s)	201, 582, 667
MslI	CAYNNNNRTG	1 cut(s)	401
Msp20I	TGGCCA	1 cut(s)	359
MspA1I	CMGCKG	1 cut(s)	64
MspR9I	CCNGG	1 cut(s)	172
MvaI	CCWGG	1 cut(s)	172
MwoI	GCNNNNNNNGC	2 cut(s)	176, 566
NdeII	GATC	2 cut(s)	311, 346
NlaIII	CATG	6 cut(s)	274, 339, 400, 406, 460, 602
NlaIV	GGNNCC	1 cut(s)	537
NmuCI	GTSAC	1 cut(s)	291
PdmI	GAANNNNTTC	1 cut(s)	607
PfeI	GAWTC	1 cut(s)	125
PkrI	GCNGC	2 cut(s)	19, 178
PleI	GAGTC	1 cut(s)	497
PpsI	GAGTC	1 cut(s)	497
PpuMI	RGGWCCY	1 cut(s)	536
Psp5II	RGGWCCY	1 cut(s)	536
Psp6I	CCWGG	1 cut(s)	170
PspGI	CCWGG	1 cut(s)	170
PspN4I	GGNNCC	1 cut(s)	537
PspPI	GGNCC	1 cut(s)	536
PspPPI	RGGWCCY	1 cut(s)	536
PstI	CTGCAG	1 cut(s)	19
PstNI	CAGNNNCTG	1 cut(s)	446
PvuII	CAGCTG	1 cut(s)	64
RsaI	GTAC	4 cut(s)	36, 68, 467, 500
RsaNI	GTAC	4 cut(s)	35, 67, 466, 499
RseI	CAYNNNNRTG	1 cut(s)	401
SaqAI	TTAA	3 cut(s)	201, 582, 667
SatI	GCNGC	2 cut(s)	18, 177
Sau3AI	GATC	2 cut(s)	311, 346
Sau96I	GGNCC	1 cut(s)	536
SchI	GAGTC	1 cut(s)	498
ScrFI	CCNGG	1 cut(s)	172
SduI	GDGCHC	1 cut(s)	643
SetI	ASST	6 cut(s)	66, 139, 157, 198, 355, 445
SfcI	CTRYAG	1 cut(s)	15
SinI	GGWCC	1 cut(s)	536
SmiMI	CAYNNNNRTG	1 cut(s)	401
SmlI	CTYRAG	1 cut(s)	281
SmoI	CTYRAG	1 cut(s)	281
Sse9I	AATT	5 cut(s)	206, 286, 369, 380, 632
SspI	AATATT	1 cut(s)	330
SspMI	CTAG	2 cut(s)	350, 540
StyD4I	CCNGG	1 cut(s)	170
TasI	AATT	5 cut(s)	206, 286, 369, 380, 632
TatI	WGTACW	3 cut(s)	66, 465, 498
TfiI	GAWTC	1 cut(s)	125
Tru1I	TTAA	3 cut(s)	201, 582, 667
Tru9I	TTAA	3 cut(s)	201, 582, 667
TseFI	GTSAC	1 cut(s)	291
TseI	GCWGC	2 cut(s)	17, 176
Tsp45I	GTSAC	1 cut(s)	291
TspDTI	ATGAA	3 cut(s)	324, 570, 605
VpaK11BI	GGWCC	1 cut(s)	536
XapI	RAATTY	5 cut(s)	206, 286, 369, 380, 632
XcmI	CCANNNNNNNNNTGG	1 cut(s)	28
XmnI	GAANNNNTTC	1 cut(s)	607
XspI	CTAG	2 cut(s)	350, 540

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.