Rmu_ssc0000116.1_g000046

exonuclease

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000116.1
OG0025452
Physical Location & Seq
Forward (+)
219318 .. 219986
669 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000116.1_g000046.1.cds

Sequence Viewer

Length: 669 bp
atgaaaactataataaggatcaaaacactaaaatcccctgtttcaatggatgaattaagatctctcttgttaattgctgaagataagattaatcaatctttgaagtccatttctttgtctttggaggctgctatggctgcatttgatgataattccagaggtactttaccttctcattctttgaataatagtttacctaattctgaaatggtttgctcatctactacacctgctgctatcatttcaaacactaatgctcttacaagcaattcttcaaaacatattactcaatttggttgtgtgcctcaatcaactattatatctaccacacctggtgttgcttctcctattggatgcactatgcaatacgtgcctaattctgagtatatgatgagtgctgctcctgctgcattaaatggctacatcaataacccttctccttcaccatacatgttcaatggacccccaaatgacaacttatgtgctcccagtgatctaaaccgttttctagttagtgacaagtctcttggatccaagacgagcagtggtgattctgggtcaatttgtgtaggttctgttctacatcacatcatccaagaggaaggtttttgtaatatagatggttatattgatgatactaatggtaccttcatatctgattcttgttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03430 map03430
Pfam Domains
Protein Families
XPG_I XPG_N

Protein Analysis

222

Amino Acids

23.49

Weight (kDa)

4.91

Isoelectric Point (pI)

52.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025452)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0000158.1_g000020 Rmu_sc0009360.1_g000035 Rmu_ssc0000116.1_g000046

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 238
Acc36I ACCTGC 1 cut(s) 238
Acc65I GGTACC 1 cut(s) 644
AccB1I GGYRCC 1 cut(s) 644
AclWI GGATC 3 cut(s) 26, 525, 538
AcuI CTGAAG 1 cut(s) 99
AdeI CACNNNGTG 1 cut(s) 335
AfaI GTAC 2 cut(s) 163, 646
AflIII ACRYGT 1 cut(s) 450
AgsI TTSAA 6 cut(s) 45, 103, 184, 246, 276, 457
AjnI CCWGG 1 cut(s) 331
Alw21I GWGCWC 1 cut(s) 487
Alw26I GTCTC 1 cut(s) 528
AlwI GGATC 3 cut(s) 26, 525, 538
ApeKI GCWGC 5 cut(s) 128, 137, 233, 398, 407
AseI ATTAAT 1 cut(s) 90
Asp718I GGTACC 1 cut(s) 644
AspS9I GGNCC 1 cut(s) 461
AsuHPI GGTGA 2 cut(s) 435, 560
AvaII GGWCC 1 cut(s) 461
BamHI GGATCC 1 cut(s) 530
BanI GGYRCC 1 cut(s) 644
BarI GAAGNNNNNNTAC 2 cut(s) 154, 186
Bbv12I GWGCWC 1 cut(s) 487
BbvI GCAGC 5 cut(s) 115, 124, 220, 385, 394
BccI CCATC 1 cut(s) 614
BciT130I CCWGG 1 cut(s) 333
BcoDI GTCTC 1 cut(s) 528
BfaI CTAG 1 cut(s) 509
BfuAI ACCTGC 1 cut(s) 238
BglII AGATCT 1 cut(s) 59
BisI GCNGC 5 cut(s) 129, 138, 234, 399, 408
BlsI GCNGC 5 cut(s) 130, 139, 235, 400, 409
Bme1390I CCNGG 1 cut(s) 333
Bme18I GGWCC 1 cut(s) 461
BmgT120I GGNCC 1 cut(s) 461
BmiI GGNNCC 3 cut(s) 463, 532, 646
BmrFI CCNGG 1 cut(s) 333
BmrI ACTGGG 1 cut(s) 483
BmsI GCATC 1 cut(s) 344
BmuI ACTGGG 1 cut(s) 483
BplI GAGNNNNNCTC 2 cut(s) 385, 417
BsaAI YACGTR 1 cut(s) 370
Bse1I ACTGG 1 cut(s) 489
BseBI CCWGG 1 cut(s) 333
BseGI GGATG 3 cut(s) 55, 359, 591
BseMII CTCAG 1 cut(s) 372
BseNI ACTGG 1 cut(s) 489
BseXI GCAGC 5 cut(s) 115, 124, 220, 385, 394
BshNI GGYRCC 1 cut(s) 644
BsiHKAI GWGCWC 1 cut(s) 487
BsmAI GTCTC 1 cut(s) 528
Bsp1286I GDGCHC 1 cut(s) 487
Bsp143I GATC 4 cut(s) 18, 59, 493, 530
BspCNI CTCAG 1 cut(s) 373
BspLI GGNNCC 3 cut(s) 463, 532, 646
BspMI ACCTGC 1 cut(s) 238
BspPI GGATC 3 cut(s) 26, 525, 538
BspT107I GGYRCC 1 cut(s) 644
BsrI ACTGG 1 cut(s) 489
BssMI GATC 4 cut(s) 18, 59, 493, 530
Bst2UI CCWGG 1 cut(s) 333
Bst4CI ACNGT 1 cut(s) 503
BstAPI GCANNNNNTGC 1 cut(s) 370
BstBAI YACGTR 1 cut(s) 370
BstDEI CTNAG 1 cut(s) 381
BstF5I GGATG 3 cut(s) 55, 359, 591
BstKTI GATC 4 cut(s) 21, 62, 496, 533
BstMAI GTCTC 1 cut(s) 528
BstMBI GATC 4 cut(s) 18, 59, 493, 530
BstMWI GCNNNNNNNGC 5 cut(s) 134, 137, 370, 404, 407
BstNI CCWGG 1 cut(s) 333
BstNSI RCATGY 1 cut(s) 454
BstSCI CCNGG 1 cut(s) 331
BstV1I GCAGC 5 cut(s) 115, 124, 220, 385, 394
BstX2I RGATCY 2 cut(s) 59, 530
BstYI RGATCY 2 cut(s) 59, 530
BtsCI GGATG 3 cut(s) 55, 359, 591
BtsI GCAGTG 1 cut(s) 550
BtsIMutI CAGTG 2 cut(s) 496, 550
BveI ACCTGC 1 cut(s) 238
Cfr13I GGNCC 1 cut(s) 461
CsiI ACCWGGT 1 cut(s) 331
Csp6I GTAC 2 cut(s) 162, 645
CviAII CATG 1 cut(s) 451
CviJI RGCY 3 cut(s) 128, 137, 420
CviKI_1 RGCY 3 cut(s) 128, 137, 420
CviQI GTAC 2 cut(s) 162, 645
DdeI CTNAG 1 cut(s) 381
DpnI GATC 4 cut(s) 20, 61, 495, 532
DpnII GATC 4 cut(s) 18, 59, 493, 530
DraIII CACNNNGTG 1 cut(s) 335
Eco47I GGWCC 1 cut(s) 461
Eco57I CTGAAG 1 cut(s) 99
EcoRII CCWGG 1 cut(s) 331
FaeI CATG 1 cut(s) 454
FalI AAGNNNNNCTT 2 cut(s) 256, 288
FatI CATG 1 cut(s) 450
Fnu4HI GCNGC 5 cut(s) 129, 138, 234, 399, 408
FokI GGATG 3 cut(s) 62, 366, 578
Fsp4HI GCNGC 5 cut(s) 129, 138, 234, 399, 408
FspBI CTAG 1 cut(s) 509
GluI GCNGC 5 cut(s) 129, 138, 234, 399, 408
Hin1II CATG 1 cut(s) 454
HinfI GANTC 2 cut(s) 551, 659
HphI GGTGA 2 cut(s) 435, 560
Hpy166II GTNNAC 1 cut(s) 194
Hpy188I TCNGA 3 cut(s) 205, 382, 658
Hpy188III TCNNGA 1 cut(s) 156
Hpy8I GTNNAC 1 cut(s) 194
HpyAV CCTTC 5 cut(s) 180, 444, 450, 596, 658
HpyCH4III ACNGT 1 cut(s) 503
HpyCH4IV ACGT 1 cut(s) 369
HpyCH4V TGCA 4 cut(s) 140, 357, 364, 410
HpyF10VI GCNNNNNNNGC 5 cut(s) 134, 137, 370, 404, 407
HpyF3I CTNAG 1 cut(s) 381
HpySE526I ACGT 1 cut(s) 369
Hsp92II CATG 1 cut(s) 454
KpnI GGTACC 1 cut(s) 648
Kzo9I GATC 4 cut(s) 18, 59, 493, 530
LmnI GCTCC 2 cut(s) 406, 490
LpnPI CCDG 8 cut(s) 51, 169, 243, 318, 345, 417, 502, 540
Lsp1109I GCAGC 5 cut(s) 115, 124, 220, 385, 394
LweI GCATC 1 cut(s) 344
MabI ACCWGGT 1 cut(s) 331
MaeI CTAG 1 cut(s) 509
MaeII ACGT 1 cut(s) 369
MaeIII GTNAC 1 cut(s) 515
MalI GATC 4 cut(s) 20, 61, 495, 532
MboI GATC 4 cut(s) 18, 59, 493, 530
MboII GAAGA 2 cut(s) 92, 264
MflI RGATCY 2 cut(s) 59, 530
MhlI GDGCHC 1 cut(s) 487
MluCI AATT 8 cut(s) 53, 72, 151, 199, 268, 290, 376, 561
MnlI CCTC 4 cut(s) 118, 152, 315, 592
MseI TTAA 5 cut(s) 56, 71, 90, 413, 667
MspR9I CCNGG 1 cut(s) 333
MvaI CCWGG 1 cut(s) 333
MwoI GCNNNNNNNGC 5 cut(s) 134, 137, 370, 404, 407
NdeII GATC 4 cut(s) 18, 59, 493, 530
NlaIII CATG 1 cut(s) 454
NlaIV GGNNCC 3 cut(s) 463, 532, 646
NmuCI GTSAC 1 cut(s) 515
NspI RCATGY 1 cut(s) 454
PaqCI CACCTGC 1 cut(s) 238
PciI ACATGT 1 cut(s) 450
PfeI GAWTC 2 cut(s) 551, 659
PkrI GCNGC 5 cut(s) 130, 139, 235, 400, 409
Ppu21I YACGTR 1 cut(s) 370
PscI ACATGT 1 cut(s) 450
PshBI ATTAAT 1 cut(s) 90
Psp6I CCWGG 1 cut(s) 331
PspGI CCWGG 1 cut(s) 331
PspN4I GGNNCC 3 cut(s) 463, 532, 646
PspPI GGNCC 1 cut(s) 461
PsrI GAACNNNNNNTAC 2 cut(s) 561, 593
PsuI RGATCY 2 cut(s) 59, 530
RsaI GTAC 2 cut(s) 163, 646
RsaNI GTAC 2 cut(s) 162, 645
SaqAI TTAA 5 cut(s) 56, 71, 90, 413, 667
SatI GCNGC 5 cut(s) 129, 138, 234, 399, 408
Sau3AI GATC 4 cut(s) 18, 59, 493, 530
Sau96I GGNCC 1 cut(s) 461
ScrFI CCNGG 1 cut(s) 333
SduI GDGCHC 1 cut(s) 487
SetI ASST 9 cut(s) 163, 172, 199, 232, 334, 372, 574, 607, 650
SexAI ACCWGGT 1 cut(s) 331
SfaNI GCATC 1 cut(s) 344
SinI GGWCC 1 cut(s) 461
Sse9I AATT 8 cut(s) 53, 72, 151, 199, 268, 290, 376, 561
SspMI CTAG 1 cut(s) 509
StyD4I CCNGG 1 cut(s) 331
TaaI ACNGT 1 cut(s) 503
TaiI ACGT 1 cut(s) 372
TasI AATT 8 cut(s) 53, 72, 151, 199, 268, 290, 376, 561
TfiI GAWTC 2 cut(s) 551, 659
Tru1I TTAA 5 cut(s) 56, 71, 90, 413, 667
Tru9I TTAA 5 cut(s) 56, 71, 90, 413, 667
TscAI CASTG 2 cut(s) 496, 550
TseFI GTSAC 1 cut(s) 515
TseI GCWGC 5 cut(s) 128, 137, 233, 398, 407
Tsp45I GTSAC 1 cut(s) 515
TspDTI ATGAA 3 cut(s) 17, 66, 640
TspRI CASTG 2 cut(s) 496, 550
VpaK11BI GGWCC 1 cut(s) 461
VspI ATTAAT 1 cut(s) 90
XceI RCATGY 1 cut(s) 454
XspI CTAG 1 cut(s) 509
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.