Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000177.1

Orthogroup ID

OG0025458

Physical Location & Seq

Genomic Coordinates Reverse (-)

101869 .. 104102

Gene Structure 2234 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000177.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 363 bp

atgctatacaatgtgggaactatttataagacacatgatgtttcactagaaatttttggttgcaaaccgaaagatgtagtttggtttggagtttcgcggaatctgaagatcaagaccggcacttgtaaacgcctcgttaaggagtttcattcttatgagaaagaggttgagagagaggctgtgaaaacagcagacatgaaggggaaaggagctgatccttatgacctcaagcaacaggctgagttggaagaagagttgaaccagaaggaagactctgaaattgaagaagcttggatggttggaccattattgcagaagttgataagttgttccagacaacggaagcctagtcttcggccttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0044424 GO:0044444 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

TBCA

Protein Analysis

120

Amino Acids

13.86

Weight (kDa)

7.67

Isoelectric Point (pI)

41.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0025458)

Species	Orthologous Gene IDs
rosa_multiflora	Rmu_ssc0000177.1_g000015
rosa_samantha	Rh1AG165700 Rh1CG154300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	27
AccII	CGCG	1 cut(s)	97
AciI	CCGC	1 cut(s)	97
AclWI	GGATC	1 cut(s)	209
AcsI	RAATTY	1 cut(s)	51
AcuI	CTGAAG	1 cut(s)	125
AfiI	CCNNNNNNNGG	2 cut(s)	139, 339
AgsI	TTSAA	2 cut(s)	259, 284
AluBI	AGCT	2 cut(s)	212, 290
AluI	AGCT	2 cut(s)	212, 290
AlwI	GGATC	1 cut(s)	209
AoxI	GGCC	1 cut(s)	356
ApoI	RAATTY	1 cut(s)	51
AspS9I	GGNCC	1 cut(s)	302
AvaII	GGWCC	1 cut(s)	302
BbsI	GAAGAC	2 cut(s)	276, 344
BccI	CCATC	1 cut(s)	289
BfaI	CTAG	2 cut(s)	47, 348
Bme18I	GGWCC	1 cut(s)	302
BmgT120I	GGNCC	1 cut(s)	302
BpiI	GAAGAC	2 cut(s)	276, 344
BpuEI	CTTGAG	1 cut(s)	212
Bsc4I	CCNNNNNNNGG	2 cut(s)	139, 339
Bse118I	RCCGGY	1 cut(s)	116
BseGI	GGATG	1 cut(s)	300
BseLI	CCNNNNNNNGG	2 cut(s)	139, 339
BseMII	CTCAG	1 cut(s)	231
Bsh1236I	CGCG	1 cut(s)	97
BshFI	GGCC	1 cut(s)	358
BsiSI	CCGG	1 cut(s)	117
BslI	CCNNNNNNNGG	2 cut(s)	139, 339
BsnI	GGCC	1 cut(s)	358
Bsp143I	GATC	2 cut(s)	108, 214
BspACI	CCGC	1 cut(s)	97
BspANI	GGCC	1 cut(s)	358
BspCNI	CTCAG	1 cut(s)	232
BspFNI	CGCG	1 cut(s)	97
BspPI	GGATC	1 cut(s)	209
BsrFI	RCCGGY	1 cut(s)	116
BssAI	RCCGGY	1 cut(s)	116
BssMI	GATC	2 cut(s)	108, 214
Bst6I	CTCTTC	1 cut(s)	246
BstDEI	CTNAG	2 cut(s)	240, 360
BstENI	CCTNNNNNAGG	1 cut(s)	137
BstF5I	GGATG	1 cut(s)	300
BstFNI	CGCG	1 cut(s)	97
BstKTI	GATC	2 cut(s)	111, 217
BstMBI	GATC	2 cut(s)	108, 214
BstUI	CGCG	1 cut(s)	97
BstV2I	GAAGAC	2 cut(s)	276, 344
BsuRI	GGCC	1 cut(s)	358
BtsCI	GGATG	1 cut(s)	300
Cfr10I	RCCGGY	1 cut(s)	116
Cfr13I	GGNCC	1 cut(s)	302
CviAII	CATG	2 cut(s)	35, 196
CviJI	RGCY	6 cut(s)	179, 212, 239, 290, 346, 358
CviKI_1	RGCY	6 cut(s)	179, 212, 239, 290, 346, 358
DdeI	CTNAG	2 cut(s)	240, 360
DpnI	GATC	2 cut(s)	110, 216
DpnII	GATC	2 cut(s)	108, 214
Eam1104I	CTCTTC	1 cut(s)	246
EarI	CTCTTC	1 cut(s)	246
Eco47I	GGWCC	1 cut(s)	302
Eco57I	CTGAAG	1 cut(s)	125
EcoNI	CCTNNNNNAGG	1 cut(s)	137
FaeI	CATG	2 cut(s)	38, 199
FaiI	YATR	6 cut(s)	7, 27, 36, 156, 197, 222
FatI	CATG	2 cut(s)	34, 195
FokI	GGATG	1 cut(s)	307
FspBI	CTAG	2 cut(s)	47, 348
HaeIII	GGCC	1 cut(s)	358
HapII	CCGG	1 cut(s)	117
Hin1II	CATG	2 cut(s)	38, 199
HindIII	AAGCTT	1 cut(s)	288
HinfI	GANTC	2 cut(s)	100, 272
HpaII	CCGG	1 cut(s)	117
Hpy166II	GTNNAC	1 cut(s)	128
Hpy188I	TCNGA	2 cut(s)	105, 277
Hpy188III	TCNNGA	2 cut(s)	112, 333
Hpy8I	GTNNAC	1 cut(s)	128
HpyAV	CCTTC	2 cut(s)	193, 259
HpyCH4V	TGCA	2 cut(s)	63, 313
HpyF3I	CTNAG	2 cut(s)	240, 360
Hsp92II	CATG	2 cut(s)	38, 199
Kzo9I	GATC	2 cut(s)	108, 214
LmnI	GCTCC	1 cut(s)	209
LpnPI	CCDG	4 cut(s)	130, 221, 275, 346
MaeI	CTAG	2 cut(s)	47, 348
MalI	GATC	2 cut(s)	110, 216
MboI	GATC	2 cut(s)	108, 214
MboII	GAAGA	6 cut(s)	118, 260, 263, 281, 296, 344
MluCI	AATT	2 cut(s)	51, 279
MlyI	GAGTC	1 cut(s)	266
MmeI	TCCRAC	2 cut(s)	225, 280
MnlI	CCTC	4 cut(s)	143, 157, 169, 236
MseI	TTAA	1 cut(s)	138
MslI	CAYNNNNRTG	1 cut(s)	153
MspI	CCGG	1 cut(s)	117
MvnI	CGCG	1 cut(s)	97
NdeII	GATC	2 cut(s)	108, 214
NlaIII	CATG	2 cut(s)	38, 199
PfeI	GAWTC	1 cut(s)	100
PleI	GAGTC	1 cut(s)	266
PpsI	GAGTC	1 cut(s)	266
PsiI	TTATAA	1 cut(s)	27
PspPI	GGNCC	1 cut(s)	302
RseI	CAYNNNNRTG	1 cut(s)	153
SaqAI	TTAA	1 cut(s)	138
Sau3AI	GATC	2 cut(s)	108, 214
Sau96I	GGNCC	1 cut(s)	302
SchI	GAGTC	1 cut(s)	266
SetI	ASST	4 cut(s)	168, 214, 228, 292
SinI	GGWCC	1 cut(s)	302
SmiMI	CAYNNNNRTG	1 cut(s)	153
SmlI	CTYRAG	1 cut(s)	227
SmoI	CTYRAG	1 cut(s)	227
Sse9I	AATT	2 cut(s)	51, 279
SsiI	CCGC	1 cut(s)	97
SspMI	CTAG	2 cut(s)	47, 348
TasI	AATT	2 cut(s)	51, 279
TfiI	GAWTC	1 cut(s)	100
Tru1I	TTAA	1 cut(s)	138
Tru9I	TTAA	1 cut(s)	138
TspDTI	ATGAA	2 cut(s)	137, 212
TspGWI	ACGGA	1 cut(s)	355
VpaK11BI	GGWCC	1 cut(s)	302
XagI	CCTNNNNNAGG	1 cut(s)	137
XapI	RAATTY	1 cut(s)	51
XspI	CTAG	2 cut(s)	47, 348

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.