Rmu_ssc0000182.1_g000005

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000182.1
Physical Location & Seq
Forward (+)
23281 .. 23568
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000182.1_g000005.1.cds

Sequence Viewer

Length: 288 bp
atgggttttgtgggaagcttgagttgggtcaatgccattgggaggaagaagtgtaggagcttgttctggagaatgagagctgcattgaagagagctatgaagaattctgggaagcagaggaggttcatgttccagtatgatccttcaagctatgctctgaactttgatgatgggtgttggaaacttggggagggaggagcttgtgctttgagacctgcaaagcttcaagaacattcagatatcaacaaaactctctgggtttgtgttcttttggtgaaatctgagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

95

Amino Acids

10.86

Weight (kDa)

9.97

Isoelectric Point (pI)

50.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015167)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 223
AclWI GGATC 1 cut(s) 134
AcsI RAATTY 1 cut(s) 103
AfiI CCNNNNNNNGG 1 cut(s) 42
AgsI TTSAA 3 cut(s) 88, 147, 227
AjuI GAANNNNNNNTTGG 2 cut(s) 7, 39
AluBI AGCT 7 cut(s) 18, 60, 80, 95, 150, 200, 223
AluI AGCT 7 cut(s) 18, 60, 80, 95, 150, 200, 223
Alw26I GTCTC 1 cut(s) 205
AlwI GGATC 1 cut(s) 134
ApeKI GCWGC 1 cut(s) 80
ApoI RAATTY 1 cut(s) 103
AsuHPI GGTGA 1 cut(s) 286
BbvI GCAGC 1 cut(s) 67
BccI CCATC 1 cut(s) 164
BcoDI GTCTC 1 cut(s) 205
BfuAI ACCTGC 1 cut(s) 223
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
BpmI CTGGAG 1 cut(s) 88
BpuEI CTTGAG 1 cut(s) 40
BsaI GGTCTC 1 cut(s) 205
Bsc4I CCNNNNNNNGG 1 cut(s) 42
Bse1I ACTGG 1 cut(s) 133
BseLI CCNNNNNNNGG 1 cut(s) 42
BseMII CTCAG 1 cut(s) 273
BseNI ACTGG 1 cut(s) 133
BseRI GAGGAG 2 cut(s) 133, 210
BseXI GCAGC 1 cut(s) 67
BslI CCNNNNNNNGG 1 cut(s) 42
BsmAI GTCTC 1 cut(s) 205
Bso31I GGTCTC 1 cut(s) 205
Bsp143I GATC 1 cut(s) 139
BspCNI CTCAG 1 cut(s) 274
BspMI ACCTGC 1 cut(s) 223
BspPI GGATC 1 cut(s) 134
BspTNI GGTCTC 1 cut(s) 205
BsrI ACTGG 1 cut(s) 133
BssMI GATC 1 cut(s) 139
Bst6I CTCTTC 1 cut(s) 83
BstDEI CTNAG 1 cut(s) 282
BstKTI GATC 1 cut(s) 142
BstMAI GTCTC 1 cut(s) 205
BstMBI GATC 1 cut(s) 139
BstV1I GCAGC 1 cut(s) 67
BveI ACCTGC 1 cut(s) 223
CviAII CATG 1 cut(s) 127
CviJI RGCY 7 cut(s) 18, 60, 80, 95, 150, 200, 223
CviKI_1 RGCY 7 cut(s) 18, 60, 80, 95, 150, 200, 223
DdeI CTNAG 1 cut(s) 282
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
Eam1104I CTCTTC 1 cut(s) 83
EarI CTCTTC 1 cut(s) 83
Eco31I GGTCTC 1 cut(s) 205
Eco32I GATATC 1 cut(s) 241
EcoRI GAATTC 1 cut(s) 103
EcoRV GATATC 1 cut(s) 241
FaeI CATG 1 cut(s) 130
FaiI YATR 4 cut(s) 98, 128, 138, 153
FatI CATG 1 cut(s) 126
Fnu4HI GCNGC 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 81
GluI GCNGC 1 cut(s) 81
GsuI CTGGAG 1 cut(s) 88
Hin1II CATG 1 cut(s) 130
HindIII AAGCTT 2 cut(s) 16, 221
HphI GGTGA 1 cut(s) 286
Hpy188I TCNGA 3 cut(s) 159, 238, 283
Hpy188III TCNNGA 2 cut(s) 67, 227
HpyAV CCTTC 1 cut(s) 153
HpyCH4V TGCA 2 cut(s) 83, 218
HpyF3I CTNAG 1 cut(s) 282
Hsp92II CATG 1 cut(s) 130
Kzo9I GATC 1 cut(s) 139
LmnI GCTCC 2 cut(s) 57, 197
LpnPI CCDG 5 cut(s) 52, 93, 146, 228, 241
Lsp1109I GCAGC 1 cut(s) 67
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MboII GAAGA 3 cut(s) 58, 100, 112
MluCI AATT 1 cut(s) 103
MmeI TCCRAC 1 cut(s) 158
MnlI CCTC 5 cut(s) 36, 111, 114, 184, 188
NdeII GATC 1 cut(s) 139
NlaIII CATG 1 cut(s) 130
PkrI GCNGC 1 cut(s) 82
SatI GCNGC 1 cut(s) 81
Sau3AI GATC 1 cut(s) 139
SetI ASST 9 cut(s) 20, 62, 82, 97, 125, 152, 202, 217, 225
SmlI CTYRAG 1 cut(s) 19
SmoI CTYRAG 1 cut(s) 19
Sse9I AATT 1 cut(s) 103
TasI AATT 1 cut(s) 103
TseI GCWGC 1 cut(s) 80
TspDTI ATGAA 2 cut(s) 113, 115
XapI RAATTY 1 cut(s) 103
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.