Rmu_ssc0000243.1_g000016

Plant invertase/pectin methylesterase inhibitor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000243.1
Physical Location & Seq
Forward (+)
58672 .. 59238
567 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000243.1_g000016.1.cds

Sequence Viewer

Length: 567 bp
atggtgaaatattatcatatcctgtgtctctcaactctatccttgtttcaatgcttcttcttcttcataccatgtgctgctaccactactaccaagtctgctggaattcagccaaccaagcttgtagacgctgtttgtcggaaaacttattcgagctactctttctgtgtggagtctctctatagcgacccaaggactccaactgctgacagctatgtgcttgcctacatctcctttggcttggcgtacctcaatgcctccaccacccaacagcatgttgcccgcctgttaaacaagacagcagcagggcatagccagcagcagctgcaaagatgttaccatgattacaacaaggccatttctgcgctgcaactcgcttacaacgacctcaattccgaaactttctttgagcttgctgatttggcaggtgttgcttctcttgctgccgatgattgccaagctgctttgaataccactttttcccctctcaccaacatgaatagtgatctcaagggtctctgtaaaatctgtgtggttgtctctaaactctttactggattactctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

188

Amino Acids

20.67

Weight (kDa)

7.52

Isoelectric Point (pI)

25.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018391)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g00110
prunus_persica Prupe.4G001200_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0000141
rosa_multiflora Rmu_ssc0000243.1_g000016
rosa_roxburghii Rroxscaffold_1G00075950
rosa_rugosa Rorug04G0381900
rosa_samantha Rh5BG002300 Rh5CG001100 Rh5DG001000
rosa_wichuraiana Rw5G000130

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 416
Acc36I ACCTGC 1 cut(s) 416
AccI GTMKAC 1 cut(s) 126
AciI CCGC 1 cut(s) 283
AcsI RAATTY 1 cut(s) 105
AfaI GTAC 1 cut(s) 248
AgsI TTSAA 2 cut(s) 50, 469
AluBI AGCT 6 cut(s) 121, 156, 213, 325, 412, 461
AluI AGCT 6 cut(s) 121, 156, 213, 325, 412, 461
Alw26I GTCTC 4 cut(s) 32, 180, 521, 544
AlwNI CAGNNNCTG 1 cut(s) 325
AoxI GGCC 1 cut(s) 354
ApeKI GCWGC 8 cut(s) 77, 302, 319, 322, 325, 367, 443, 461
ApoI RAATTY 1 cut(s) 105
AspLEI GCGC 1 cut(s) 367
AsuHPI GGTGA 2 cut(s) 16, 481
BbvI GCAGC 8 cut(s) 64, 312, 314, 331, 334, 354, 430, 448
BcoDI GTCTC 4 cut(s) 32, 180, 521, 544
BfmI CTRYAG 1 cut(s) 181
BfuAI ACCTGC 1 cut(s) 416
BisI GCNGC 8 cut(s) 78, 303, 320, 323, 326, 368, 444, 462
BlsI GCNGC 8 cut(s) 79, 304, 321, 324, 327, 369, 445, 463
BpuEI CTTGAG 1 cut(s) 494
BsaI GGTCTC 1 cut(s) 521
BsaJI CCNNGG 1 cut(s) 191
Bse1I ACTGG 1 cut(s) 559
BseDI CCNNGG 1 cut(s) 191
BseNI ACTGG 1 cut(s) 559
BseXI GCAGC 8 cut(s) 64, 312, 314, 331, 334, 354, 430, 448
BshFI GGCC 1 cut(s) 356
BsmAI GTCTC 4 cut(s) 32, 180, 521, 544
BsnI GGCC 1 cut(s) 356
Bso31I GGTCTC 1 cut(s) 521
Bsp143I GATC 1 cut(s) 505
BspACI CCGC 1 cut(s) 283
BspANI GGCC 1 cut(s) 356
BspMI ACCTGC 1 cut(s) 416
BspTNI GGTCTC 1 cut(s) 521
BsrI ACTGG 1 cut(s) 559
BssECI CCNNGG 1 cut(s) 191
BssMI GATC 1 cut(s) 505
BssT1I CCWWGG 1 cut(s) 191
BstAPI GCANNNNNTGC 2 cut(s) 325, 431
BstC8I GCNNGC 4 cut(s) 222, 283, 317, 414
BstHHI GCGC 1 cut(s) 367
BstKTI GATC 1 cut(s) 508
BstMAI GTCTC 4 cut(s) 32, 180, 521, 544
BstMBI GATC 1 cut(s) 505
BstMWI GCNNNNNNNGC 7 cut(s) 118, 316, 325, 362, 422, 431, 440
BstNSI RCATGY 1 cut(s) 278
BstSFI CTRYAG 1 cut(s) 181
BstV1I GCAGC 8 cut(s) 64, 312, 314, 331, 334, 354, 430, 448
BsuRI GGCC 1 cut(s) 356
BveI ACCTGC 1 cut(s) 416
Cac8I GCNNGC 4 cut(s) 222, 283, 317, 414
CaiI CAGNNNCTG 1 cut(s) 325
CfoI GCGC 1 cut(s) 367
CseI GACGC 1 cut(s) 137
Csp6I GTAC 1 cut(s) 247
CviAII CATG 4 cut(s) 72, 275, 341, 496
CviQI GTAC 1 cut(s) 247
DpnI GATC 1 cut(s) 507
DpnII GATC 1 cut(s) 505
Eco130I CCWWGG 1 cut(s) 191
Eco31I GGTCTC 1 cut(s) 521
EcoRI GAATTC 1 cut(s) 105
EcoT14I CCWWGG 1 cut(s) 191
ErhI CCWWGG 1 cut(s) 191
FaeI CATG 4 cut(s) 75, 278, 344, 499
FaiI YATR 9 cut(s) 18, 68, 73, 183, 216, 276, 312, 342, 497
FatI CATG 4 cut(s) 71, 274, 340, 495
FauI CCCGC 1 cut(s) 290
FblI GTMKAC 1 cut(s) 126
Fnu4HI GCNGC 8 cut(s) 78, 303, 320, 323, 326, 368, 444, 462
Fsp4HI GCNGC 8 cut(s) 78, 303, 320, 323, 326, 368, 444, 462
GlaI GCGC 1 cut(s) 366
GluI GCNGC 8 cut(s) 78, 303, 320, 323, 326, 368, 444, 462
HaeIII GGCC 1 cut(s) 356
HgaI GACGC 1 cut(s) 137
HhaI GCGC 1 cut(s) 367
Hin1II CATG 4 cut(s) 75, 278, 344, 499
Hin6I GCGC 1 cut(s) 365
HinP1I GCGC 1 cut(s) 365
HindIII AAGCTT 1 cut(s) 119
HinfI GANTC 2 cut(s) 173, 196
HphI GGTGA 2 cut(s) 16, 481
Hpy166II GTNNAC 1 cut(s) 127
Hpy188I TCNGA 3 cut(s) 141, 397, 566
Hpy8I GTNNAC 1 cut(s) 127
HpyCH4V TGCA 2 cut(s) 328, 370
HpyF10VI GCNNNNNNNGC 7 cut(s) 118, 316, 325, 362, 422, 431, 440
Hsp92II CATG 4 cut(s) 75, 278, 344, 499
HspAI GCGC 1 cut(s) 365
Kzo9I GATC 1 cut(s) 505
LpnPI CCDG 7 cut(s) 35, 87, 291, 299, 329, 411, 540
Lsp1109I GCAGC 8 cut(s) 64, 312, 314, 331, 334, 354, 430, 448
MaeIII GTNAC 1 cut(s) 335
MalI GATC 1 cut(s) 507
MboI GATC 1 cut(s) 505
MboII GAAGA 3 cut(s) 49, 52, 55
MluCI AATT 2 cut(s) 105, 391
MlyI GAGTC 2 cut(s) 182, 190
MmeI TCCRAC 2 cut(s) 119, 224
MnlI CCTC 4 cut(s) 260, 268, 398, 495
MseI TTAA 1 cut(s) 290
MslI CAYNNNNRTG 1 cut(s) 494
MspA1I CMGCKG 1 cut(s) 325
MwoI GCNNNNNNNGC 7 cut(s) 118, 316, 325, 362, 422, 431, 440
NdeII GATC 1 cut(s) 505
NlaIII CATG 4 cut(s) 75, 278, 344, 499
NspI RCATGY 1 cut(s) 278
PaqCI CACCTGC 1 cut(s) 416
PcsI WCGNNNNNNNCGW 1 cut(s) 381
PkrI GCNGC 8 cut(s) 79, 304, 321, 324, 327, 369, 445, 463
PleI GAGTC 2 cut(s) 181, 190
PpsI GAGTC 2 cut(s) 181, 190
PstNI CAGNNNCTG 1 cut(s) 325
PvuII CAGCTG 1 cut(s) 325
RsaI GTAC 1 cut(s) 248
RsaNI GTAC 1 cut(s) 247
RseI CAYNNNNRTG 1 cut(s) 494
SaqAI TTAA 1 cut(s) 290
SatI GCNGC 8 cut(s) 78, 303, 320, 323, 326, 368, 444, 462
Sau3AI GATC 1 cut(s) 505
SchI GAGTC 2 cut(s) 182, 190
SetI ASST 9 cut(s) 123, 158, 215, 252, 327, 390, 414, 430, 463
SfcI CTRYAG 1 cut(s) 181
SmiMI CAYNNNNRTG 1 cut(s) 494
SmlI CTYRAG 1 cut(s) 509
SmoI CTYRAG 1 cut(s) 509
Sse9I AATT 2 cut(s) 105, 391
SsiI CCGC 1 cut(s) 283
SspI AATATT 1 cut(s) 11
StyI CCWWGG 1 cut(s) 191
TaqI TCGA 1 cut(s) 152
TasI AATT 2 cut(s) 105, 391
Tru1I TTAA 1 cut(s) 290
Tru9I TTAA 1 cut(s) 290
TseI GCWGC 8 cut(s) 77, 302, 319, 322, 325, 367, 443, 461
TspDTI ATGAA 2 cut(s) 55, 512
XapI RAATTY 1 cut(s) 105
XceI RCATGY 1 cut(s) 278
XmiI GTMKAC 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.