Rroxscaffold_159G00432750

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000159
Physical Location & Seq
Reverse (-)
373076 .. 374733
1658 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_159G00432750.1

Sequence Viewer

Length: 183 bp
ATGGATTTACTTGTTGCTGTGAAGATCCTCAACAATTCAAATGAAAAGGGGGAAGATTTTATAAATGAAGTGGGAACAATGGGTTTTCACCATATAAATGTGGTTCGTATGGTTGGCTTCTGTGCTGATGGATATATGGAGAACAAGCTCTTGTTTACGAGTTCTTACCAAATGGTTCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.81

Weight (kDa)

5.36

Isoelectric Point (pI)

23.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0025751)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 62
AclWI GGATC 1 cut(s) 19
AgsI TTSAA 1 cut(s) 39
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
AlwI GGATC 1 cut(s) 19
AsuHPI GGTGA 1 cut(s) 80
BccI CCATC 1 cut(s) 122
Bsp143I GATC 1 cut(s) 24
BspPI GGATC 1 cut(s) 19
BssMI GATC 1 cut(s) 24
BstKTI GATC 1 cut(s) 27
BstMBI GATC 1 cut(s) 24
BstX2I RGATCY 1 cut(s) 24
BstYI RGATCY 1 cut(s) 24
CviJI RGCY 2 cut(s) 117, 148
CviKI_1 RGCY 2 cut(s) 117, 148
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
FaiI YATR 6 cut(s) 62, 93, 95, 110, 135, 137
HphI GGTGA 1 cut(s) 80
Hpy166II GTNNAC 1 cut(s) 156
Hpy8I GTNNAC 1 cut(s) 156
Kzo9I GATC 1 cut(s) 24
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MboII GAAGA 2 cut(s) 34, 65
MflI RGATCY 1 cut(s) 24
MluCI AATT 1 cut(s) 34
MnlI CCTC 1 cut(s) 38
MslI CAYNNNNRTG 1 cut(s) 96
NdeII GATC 1 cut(s) 24
PsiI TTATAA 1 cut(s) 62
PsuI RGATCY 1 cut(s) 24
RseI CAYNNNNRTG 1 cut(s) 96
Sau3AI GATC 1 cut(s) 24
SetI ASST 1 cut(s) 150
SgeI CNNG 4 cut(s) 23, 157, 163, 171
SmiMI CAYNNNNRTG 1 cut(s) 96
Sse9I AATT 1 cut(s) 34
TasI AATT 1 cut(s) 34
TspDTI ATGAA 3 cut(s) 57, 81, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.