Rroxscaffold_1G00036380

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0022779
Physical Location & Seq
Forward (+)
53143045 .. 53147487
4443 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00036380.1

Sequence Viewer

Length: 252 bp
ATGAAGCTGTGGTCAGTTAATGCACTGCTCGGGGATGCAGAGGAGAAGCAATTTAAAAACTCAAGAGTGTGGGAATGGCTTGATGAGATTAAAGATGCTCTCTATCAAGCTGACGACCTGCTGTATGAGATCAATACTGGAGCTCTACGCCACAAGCTGGAAGAAGATTCTGGAACCAGCAGAACAAGTCAGCTACTGAACTTCAGTTCTGCTCCCATCTATGAACTTGACAAAATTTTAATACATTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NB-ARC

Protein Analysis

83

Amino Acids

9.67

Weight (kDa)

4.72

Isoelectric Point (pI)

37.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rx_N PF18052 2 - 58 2.5e-13 Rx N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022779)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0045911
rosa_roxburghii Rroxscaffold_1G00035300 Rroxscaffold_1G00036380
rosa_samantha Rh5DG326000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 126
AccB7I CCANNNNNTGG 1 cut(s) 157
AcsI RAATTY 1 cut(s) 234
AcuI CTGAAG 1 cut(s) 187
AfiI CCNNNNNNNGG 1 cut(s) 157
AluBI AGCT 5 cut(s) 7, 110, 143, 157, 193
AluI AGCT 5 cut(s) 7, 110, 143, 157, 193
Alw21I GWGCWC 1 cut(s) 145
AlwNI CAGNNNCTG 1 cut(s) 196
Ama87I CYCGRG 1 cut(s) 29
ApoI RAATTY 1 cut(s) 234
AvaI CYCGRG 1 cut(s) 29
BanII GRGCYC 1 cut(s) 145
Bbv12I GWGCWC 1 cut(s) 145
BccI CCATC 1 cut(s) 224
BfuAI ACCTGC 1 cut(s) 126
BmeT110I CYCGRG 1 cut(s) 29
BmiI GGNNCC 1 cut(s) 175
BmsI GCATC 2 cut(s) 25, 85
BpmI CTGGAG 1 cut(s) 159
BpuEI CTTGAG 1 cut(s) 46
Bsc4I CCNNNNNNNGG 1 cut(s) 157
Bse1I ACTGG 1 cut(s) 142
BseGI GGATG 1 cut(s) 40
BseLI CCNNNNNNNGG 1 cut(s) 157
BseNI ACTGG 1 cut(s) 142
BseRI GAGGAG 1 cut(s) 56
BsiHKAI GWGCWC 1 cut(s) 145
BsiHKCI CYCGRG 1 cut(s) 29
BslI CCNNNNNNNGG 1 cut(s) 157
BsoBI CYCGRG 1 cut(s) 29
Bsp1286I GDGCHC 1 cut(s) 145
Bsp143I GATC 1 cut(s) 129
BspLI GGNNCC 1 cut(s) 175
BspMI ACCTGC 1 cut(s) 126
BsrI ACTGG 1 cut(s) 142
BssMI GATC 1 cut(s) 129
BstF5I GGATG 1 cut(s) 40
BstKTI GATC 1 cut(s) 132
BstMBI GATC 1 cut(s) 129
BtsCI GGATG 1 cut(s) 40
BtsI GCAGTG 1 cut(s) 23
BtsIMutI CAGTG 1 cut(s) 23
BveI ACCTGC 1 cut(s) 126
CaiI CAGNNNCTG 1 cut(s) 196
CviJI RGCY 6 cut(s) 7, 79, 110, 143, 157, 193
CviKI_1 RGCY 6 cut(s) 7, 79, 110, 143, 157, 193
DpnI GATC 1 cut(s) 131
DpnII GATC 1 cut(s) 129
DraI TTTAAA 1 cut(s) 55
Ecl136II GAGCTC 1 cut(s) 143
Eco24I GRGCYC 1 cut(s) 145
Eco53kI GAGCTC 1 cut(s) 143
Eco57I CTGAAG 1 cut(s) 187
Eco88I CYCGRG 1 cut(s) 29
EcoICRI GAGCTC 1 cut(s) 143
EcoT38I GRGCYC 1 cut(s) 145
FaiI YATR 2 cut(s) 126, 222
FokI GGATG 1 cut(s) 47
FriOI GRGCYC 1 cut(s) 145
GsuI CTGGAG 1 cut(s) 159
HinfI GANTC 1 cut(s) 167
Hpy188III TCNNGA 2 cut(s) 63, 171
HpyCH4V TGCA 2 cut(s) 23, 38
Kzo9I GATC 1 cut(s) 129
LmnI GCTCC 2 cut(s) 140, 217
LpnPI CCDG 5 cut(s) 123, 131, 143, 156, 190
LweI GCATC 2 cut(s) 25, 85
MalI GATC 1 cut(s) 131
MboI GATC 1 cut(s) 129
MboII GAAGA 2 cut(s) 173, 176
MhlI GDGCHC 1 cut(s) 145
MluCI AATT 2 cut(s) 50, 234
MnlI CCTC 1 cut(s) 34
MseI TTAA 4 cut(s) 18, 54, 90, 239
NdeII GATC 1 cut(s) 129
NlaIV GGNNCC 1 cut(s) 175
PfeI GAWTC 1 cut(s) 167
PflMI CCANNNNNTGG 1 cut(s) 157
Psp124BI GAGCTC 1 cut(s) 145
PspN4I GGNNCC 1 cut(s) 175
PstNI CAGNNNCTG 1 cut(s) 196
SacI GAGCTC 1 cut(s) 145
SaqAI TTAA 4 cut(s) 18, 54, 90, 239
Sau3AI GATC 1 cut(s) 129
SduI GDGCHC 1 cut(s) 145
SetI ASST 6 cut(s) 9, 112, 120, 145, 159, 195
SfaNI GCATC 2 cut(s) 25, 85
SmlI CTYRAG 1 cut(s) 61
SmoI CTYRAG 1 cut(s) 61
Sse9I AATT 2 cut(s) 50, 234
SstI GAGCTC 1 cut(s) 145
TasI AATT 2 cut(s) 50, 234
TfiI GAWTC 1 cut(s) 167
Tru1I TTAA 4 cut(s) 18, 54, 90, 239
Tru9I TTAA 4 cut(s) 18, 54, 90, 239
TscAI CASTG 1 cut(s) 30
TspDTI ATGAA 2 cut(s) 17, 237
TspRI CASTG 1 cut(s) 30
Van91I CCANNNNNTGG 1 cut(s) 157
XapI RAATTY 1 cut(s) 234
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.