Rroxscaffold_1G00040160

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
57781125 .. 57781695
571 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00040160.1

Sequence Viewer

Length: 174 bp
ATGACTCAAACCATGACGCTAGCCACAATCGGATATATGGCTCCAGAGTCACCAGAAGGAAGGATAAATATGGAAGATGCTGTAGTCGCACTTAATAAAATCATGATCAAGTTTTTGAAGGACGCTGCAGGAGGTGTGGTTTTACGCCGCCCTCCTGCTCAACAGCCCCTTTAG

Protein Analysis

57

Amino Acids

6.19

Weight (kDa)

8.19

Isoelectric Point (pI)

71.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022477)

Species Orthologous Gene IDs
prunus_persica Prupe.4G076600_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0059141 RchiOBHm_Chr7g0213291
rosa_roxburghii Rroxscaffold_1G00040160

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 148
AgsI TTSAA 1 cut(s) 118
ApeKI GCWGC 1 cut(s) 125
AsuHPI GGTGA 1 cut(s) 42
AsuNHI GCTAGC 1 cut(s) 19
BbvI GCAGC 1 cut(s) 112
BclI TGATCA 1 cut(s) 105
BfaI CTAG 1 cut(s) 20
BfmI CTRYAG 2 cut(s) 81, 126
BisI GCNGC 2 cut(s) 126, 148
BlsI GCNGC 2 cut(s) 127, 149
BmiI GGNNCC 1 cut(s) 42
BmsI GCATC 1 cut(s) 67
BmtI GCTAGC 1 cut(s) 23
BpmI CTGGAG 1 cut(s) 27
BsaXI ACNNNNNCTCC 2 cut(s) 123, 153
BseXI GCAGC 1 cut(s) 112
Bsp143I GATC 1 cut(s) 105
BspACI CCGC 1 cut(s) 148
BspHI TCATGA 1 cut(s) 102
BspLI GGNNCC 1 cut(s) 42
BspMAI CTGCAG 1 cut(s) 130
BspOI GCTAGC 1 cut(s) 23
BssMI GATC 1 cut(s) 105
BstC8I GCNNGC 1 cut(s) 21
BstKTI GATC 1 cut(s) 108
BstMBI GATC 1 cut(s) 105
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstSFI CTRYAG 2 cut(s) 81, 126
BstV1I GCAGC 1 cut(s) 112
Cac8I GCNNGC 1 cut(s) 21
CciI TCATGA 1 cut(s) 102
CseI GACGC 2 cut(s) 25, 131
CviAII CATG 2 cut(s) 13, 103
CviJI RGCY 3 cut(s) 23, 41, 166
CviKI_1 RGCY 3 cut(s) 23, 41, 166
DpnI GATC 1 cut(s) 107
DpnII GATC 1 cut(s) 105
FaeI CATG 2 cut(s) 16, 106
FaiI YATR 5 cut(s) 14, 36, 38, 71, 104
FatI CATG 2 cut(s) 12, 102
FbaI TGATCA 1 cut(s) 105
Fnu4HI GCNGC 2 cut(s) 126, 148
Fsp4HI GCNGC 2 cut(s) 126, 148
FspBI CTAG 1 cut(s) 20
GluI GCNGC 2 cut(s) 126, 148
GsuI CTGGAG 1 cut(s) 27
HgaI GACGC 2 cut(s) 25, 131
Hin1II CATG 2 cut(s) 16, 106
HinfI GANTC 2 cut(s) 4, 47
HphI GGTGA 1 cut(s) 42
Hpy188I TCNGA 1 cut(s) 32
Hpy188III TCNNGA 2 cut(s) 44, 103
HpyAV CCTTC 3 cut(s) 50, 54, 112
HpyCH4V TGCA 1 cut(s) 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
Hsp92II CATG 2 cut(s) 16, 106
Ksp22I TGATCA 1 cut(s) 105
Kzo9I GATC 1 cut(s) 105
LmnI GCTCC 1 cut(s) 46
LpnPI CCDG 4 cut(s) 57, 66, 114, 168
Lsp1109I GCAGC 1 cut(s) 112
LweI GCATC 1 cut(s) 67
MaeI CTAG 1 cut(s) 20
MaeIII GTNAC 1 cut(s) 48
MalI GATC 1 cut(s) 107
MboI GATC 1 cut(s) 105
MboII GAAGA 1 cut(s) 86
MlyI GAGTC 1 cut(s) 56
MnlI CCTC 2 cut(s) 125, 162
MseI TTAA 1 cut(s) 93
MwoI GCNNNNNNNGC 1 cut(s) 86
NdeII GATC 1 cut(s) 105
NheI GCTAGC 1 cut(s) 19
NlaIII CATG 2 cut(s) 16, 106
NlaIV GGNNCC 1 cut(s) 42
NmuCI GTSAC 1 cut(s) 48
PagI TCATGA 1 cut(s) 102
PkrI GCNGC 2 cut(s) 127, 149
PleI GAGTC 1 cut(s) 55
PpsI GAGTC 1 cut(s) 55
PspN4I GGNNCC 1 cut(s) 42
PstI CTGCAG 1 cut(s) 130
SaqAI TTAA 1 cut(s) 93
SatI GCNGC 2 cut(s) 126, 148
Sau3AI GATC 1 cut(s) 105
SchI GAGTC 1 cut(s) 56
SetI ASST 1 cut(s) 136
SfaNI GCATC 1 cut(s) 67
SfcI CTRYAG 2 cut(s) 81, 126
SgeI CNNG 8 cut(s) 25, 32, 56, 65, 115, 121, 141, 167
SsiI CCGC 1 cut(s) 148
SspMI CTAG 1 cut(s) 20
TauI GCSGC 1 cut(s) 150
Tru1I TTAA 1 cut(s) 93
Tru9I TTAA 1 cut(s) 93
TseFI GTSAC 1 cut(s) 48
TseI GCWGC 1 cut(s) 125
Tsp45I GTSAC 1 cut(s) 48
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.