Rroxscaffold_1G00047210

Protein of unknown function (DUF1296)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
66757287 .. 66759916
2630 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00047210.1

Sequence Viewer

Length: 153 bp
ATGGCTGTATCTGGCTATTCCAATAATCTTGCCTATCCTCACATGTCTAATGGCAACACCTATTTGCTGGTGCCTGCATGTAGTTTAAGCCTGTCCTTACTAGAAGTCCCATGGGGTTTGGAAGGTTTACTAATCCAGCTGGTTATGCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.41

Weight (kDa)

4.51

Isoelectric Point (pI)

31.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021302)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0340851
rosa_roxburghii Rroxscaffold_1G00047210 Rroxscaffold_3G00230520
rosa_samantha Rh2AG562200 Rh2CG117900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 70
AflIII ACRYGT 1 cut(s) 42
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
BanI GGYRCC 1 cut(s) 70
BfaI CTAG 1 cut(s) 101
BmiI GGNNCC 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 110
BseDI CCNNGG 1 cut(s) 110
BshNI GGYRCC 1 cut(s) 70
BslFI GGGAC 1 cut(s) 92
BsmFI GGGAC 1 cut(s) 92
Bsp19I CCATGG 1 cut(s) 110
BspLI GGNNCC 1 cut(s) 72
BspT107I GGYRCC 1 cut(s) 70
BssECI CCNNGG 1 cut(s) 110
BssT1I CCWWGG 1 cut(s) 110
BstC8I GCNNGC 1 cut(s) 75
BstDSI CCRYGG 1 cut(s) 110
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstNSI RCATGY 2 cut(s) 46, 81
BtgI CCRYGG 1 cut(s) 110
Cac8I GCNNGC 1 cut(s) 75
CviAII CATG 3 cut(s) 43, 78, 111
CviJI RGCY 4 cut(s) 5, 15, 90, 139
CviKI_1 RGCY 4 cut(s) 5, 15, 90, 139
Eco130I CCWWGG 1 cut(s) 110
EcoT14I CCWWGG 1 cut(s) 110
ErhI CCWWGG 1 cut(s) 110
FaeI CATG 3 cut(s) 46, 81, 114
FaiI YATR 4 cut(s) 44, 79, 112, 146
FaqI GGGAC 1 cut(s) 92
FatI CATG 3 cut(s) 42, 77, 110
FspBI CTAG 1 cut(s) 101
Hin1II CATG 3 cut(s) 46, 81, 114
Hpy166II GTNNAC 1 cut(s) 128
Hpy8I GTNNAC 1 cut(s) 128
HpyAV CCTTC 1 cut(s) 116
HpyCH4V TGCA 2 cut(s) 77, 148
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
Hsp92II CATG 3 cut(s) 46, 81, 114
LpnPI CCDG 5 cut(s) 53, 87, 104, 125, 149
MaeI CTAG 1 cut(s) 101
MnlI CCTC 1 cut(s) 48
MseI TTAA 1 cut(s) 86
MspA1I CMGCKG 1 cut(s) 139
MwoI GCNNNNNNNGC 1 cut(s) 145
NcoI CCATGG 1 cut(s) 110
NlaIII CATG 3 cut(s) 46, 81, 114
NlaIV GGNNCC 1 cut(s) 72
NspI RCATGY 2 cut(s) 46, 81
PciI ACATGT 1 cut(s) 42
PscI ACATGT 1 cut(s) 42
PspN4I GGNNCC 1 cut(s) 72
PvuII CAGCTG 1 cut(s) 139
SaqAI TTAA 1 cut(s) 86
SetI ASST 3 cut(s) 62, 127, 141
SspMI CTAG 1 cut(s) 101
StyI CCWWGG 1 cut(s) 110
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
XceI RCATGY 2 cut(s) 46, 81
XspI CTAG 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.