Rroxscaffold_2G00101290

Hus1-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
OG0021662
Physical Location & Seq
Forward (+)
23270617 .. 23271060
444 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00101290.1

Sequence Viewer

Length: 444 bp
ATGGGAAAGATATGCCATCTCTTCCTCAACAGAGACCGTGTTTTCTTCCTCCACAACCTTCTCAACGGCAATGGAGTTCAATCCATTGCTCAGTTTAGCAAAGAAGCTCTTTTTGATGACTATCGCATGACTAGCCAGTATGATGACTGCATTGCCTTTACACTAGACATTTCTCTTCTGCACCGTGCTCTTTGTAGCAGTGCCAGCATATGTAACGAGTTTGGAAATGGGCCAACAGCCAATCGCCTACAGATTACAATAGCAAAGAAGCTTACTAAAAGTTCTACACAAAGATTGTCTTTCCTTACCTTATTTGAGACTGAGGATTATAAATCTTCCAAGACATACCAATCTCATCACCTTTGTCTAGGAATCAGGTTCTTGAACTTCAAATTGCTCTTGATATGGTTCCAGATTTTCCCCAAATTCTGGTTGAGGTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04218 map04218
Pfam Domains
Protein Families
Hus1

Protein Analysis

147

Amino Acids

17.14

Weight (kDa)

9.22

Isoelectric Point (pI)

24.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Hus1 PF04005 1 - 105 8.4e-18 Hus1-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021662)

Species Orthologous Gene IDs
rosa_multiflora Rmu_sc0003475.1_g000005 Rmu_sc0013924.1_g000002 Rmu_sc0014163.1_g000006
rosa_roxburghii Rroxscaffold_2G00101290
rosa_samantha Rh6CG239500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 330
AccB7I CCANNNNNTGG 1 cut(s) 429
AcsI RAATTY 1 cut(s) 425
AfiI CCNNNNNNNGG 1 cut(s) 429
AgsI TTSAA 3 cut(s) 80, 385, 391
AluBI AGCT 2 cut(s) 107, 271
AluI AGCT 2 cut(s) 107, 271
Alw21I GWGCWC 1 cut(s) 190
Alw26I GTCTC 2 cut(s) 27, 311
AoxI GGCC 1 cut(s) 230
ApoI RAATTY 1 cut(s) 425
AspS9I GGNCC 1 cut(s) 230
AsuHPI GGTGA 1 cut(s) 350
Bbv12I GWGCWC 1 cut(s) 190
BccI CCATC 1 cut(s) 24
BceAI ACGGC 1 cut(s) 82
BcoDI GTCTC 2 cut(s) 27, 311
BfaI CTAG 4 cut(s) 132, 164, 368, 442
BfmI CTRYAG 1 cut(s) 248
BmgT120I GGNCC 1 cut(s) 230
BmiI GGNNCC 1 cut(s) 410
BsaBI GATNNNNATC 1 cut(s) 120
BsaI GGTCTC 1 cut(s) 27
Bsc4I CCNNNNNNNGG 1 cut(s) 429
Bse1I ACTGG 1 cut(s) 136
Bse3DI GCAATG 3 cut(s) 76, 84, 150
Bse8I GATNNNNATC 1 cut(s) 120
BseJI GATNNNNATC 1 cut(s) 120
BseLI CCNNNNNNNGG 1 cut(s) 429
BseMI GCAATG 3 cut(s) 76, 84, 150
BseMII CTCAG 2 cut(s) 104, 312
BseNI ACTGG 1 cut(s) 136
BsgI GTGCAG 1 cut(s) 164
BshFI GGCC 1 cut(s) 232
BsiHKAI GWGCWC 1 cut(s) 190
BslI CCNNNNNNNGG 1 cut(s) 429
BsmAI GTCTC 2 cut(s) 27, 311
BsnI GGCC 1 cut(s) 232
Bso31I GGTCTC 1 cut(s) 27
Bsp1286I GDGCHC 1 cut(s) 190
BspANI GGCC 1 cut(s) 232
BspCNI CTCAG 2 cut(s) 103, 313
BspLI GGNNCC 1 cut(s) 410
BspTNI GGTCTC 1 cut(s) 27
BsrDI GCAATG 3 cut(s) 76, 84, 150
BsrI ACTGG 1 cut(s) 136
Bst4CI ACNGT 2 cut(s) 38, 185
Bst6I CTCTTC 2 cut(s) 26, 180
BstC8I GCNNGC 1 cut(s) 205
BstDEI CTNAG 2 cut(s) 90, 321
BstMAI GTCTC 2 cut(s) 27, 311
BstMWI GCNNNNNNNGC 2 cut(s) 132, 204
BstSFI CTRYAG 1 cut(s) 248
BsuRI GGCC 1 cut(s) 232
BtsI GCAGTG 1 cut(s) 205
BtsIMutI CAGTG 1 cut(s) 205
Cac8I GCNNGC 1 cut(s) 205
Cfr13I GGNCC 1 cut(s) 230
CviAII CATG 1 cut(s) 127
CviJI RGCY 5 cut(s) 107, 135, 232, 239, 271
CviKI_1 RGCY 5 cut(s) 107, 135, 232, 239, 271
DdeI CTNAG 2 cut(s) 90, 321
Eam1104I CTCTTC 2 cut(s) 26, 180
EarI CTCTTC 2 cut(s) 26, 180
Eco31I GGTCTC 1 cut(s) 27
FaeI CATG 1 cut(s) 130
FaiI YATR 8 cut(s) 13, 128, 141, 209, 211, 330, 346, 406
FalI AAGNNNNNCTT 4 cut(s) 93, 125, 283, 315
FatI CATG 1 cut(s) 126
FauNDI CATATG 1 cut(s) 209
FspBI CTAG 4 cut(s) 132, 164, 368, 442
HaeIII GGCC 1 cut(s) 232
Hin1II CATG 1 cut(s) 130
HindIII AAGCTT 1 cut(s) 269
HinfI GANTC 1 cut(s) 372
HphI GGTGA 1 cut(s) 350
Hpy188III TCNNGA 3 cut(s) 382, 400, 412
HpyAV CCTTC 1 cut(s) 68
HpyCH4III ACNGT 2 cut(s) 38, 185
HpyCH4V TGCA 2 cut(s) 150, 181
HpyF10VI GCNNNNNNNGC 2 cut(s) 132, 204
HpyF3I CTNAG 2 cut(s) 90, 321
Hsp92II CATG 1 cut(s) 130
LpnPI CCDG 5 cut(s) 149, 217, 361, 415, 425
MaeI CTAG 4 cut(s) 132, 164, 368, 442
MaeIII GTNAC 1 cut(s) 212
MboII GAAGA 4 cut(s) 13, 37, 167, 327
MhlI GDGCHC 1 cut(s) 190
MluCI AATT 2 cut(s) 392, 425
MnlI CCTC 4 cut(s) 35, 59, 316, 429
MwoI GCNNNNNNNGC 2 cut(s) 132, 204
NdeI CATATG 1 cut(s) 209
NlaIII CATG 1 cut(s) 130
NlaIV GGNNCC 1 cut(s) 410
PfeI GAWTC 1 cut(s) 372
PflMI CCANNNNNTGG 1 cut(s) 429
PsiI TTATAA 1 cut(s) 330
PspN4I GGNNCC 1 cut(s) 410
PspPI GGNCC 1 cut(s) 230
Sau96I GGNCC 1 cut(s) 230
SduI GDGCHC 1 cut(s) 190
SetI ASST 7 cut(s) 60, 109, 273, 311, 363, 380, 440
SfcI CTRYAG 1 cut(s) 248
Sse9I AATT 2 cut(s) 392, 425
SspMI CTAG 4 cut(s) 132, 164, 368, 442
TaaI ACNGT 2 cut(s) 38, 185
TasI AATT 2 cut(s) 392, 425
TfiI GAWTC 1 cut(s) 372
TscAI CASTG 1 cut(s) 205
TspRI CASTG 1 cut(s) 205
Van91I CCANNNNNTGG 1 cut(s) 429
XapI RAATTY 1 cut(s) 425
XspI CTAG 4 cut(s) 132, 164, 368, 442
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.