Rroxscaffold_2G00131540

Domain of unknown function (DUF4602)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
68241209 .. 68246106
4898 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00131540.1

Sequence Viewer

Length: 156 bp
ATGCATAAGAACAAGGGAGGCAACGGAGGGCGACAAATGGGTAGGAAGAACCAGAAGCCGGAAACCAAGGACCAAGAATTGGACTCCAACTACCTAAGAATGGACATGAGGGAGATTTCCAAGCGTATTGAGCTCCTGGGGAGGAGCTCATATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.98

Weight (kDa)

9.99

Isoelectric Point (pI)

74.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024955)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0391011
rosa_roxburghii Rroxscaffold_2G00131540
rosa_samantha Rh4BG131500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 79
AfiI CCNNNNNNNGG 3 cut(s) 58, 79, 100
AjnI CCWGG 1 cut(s) 135
AluBI AGCT 2 cut(s) 133, 147
AluI AGCT 2 cut(s) 133, 147
Alw21I GWGCWC 2 cut(s) 135, 149
AspS9I GGNCC 1 cut(s) 70
AvaII GGWCC 1 cut(s) 70
BanII GRGCYC 2 cut(s) 135, 149
Bbv12I GWGCWC 2 cut(s) 135, 149
BciT130I CCWGG 1 cut(s) 137
Bme1390I CCNGG 1 cut(s) 137
Bme18I GGWCC 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 70
BmrFI CCNGG 1 cut(s) 137
BsaJI CCNNGG 2 cut(s) 66, 136
Bsc4I CCNNNNNNNGG 3 cut(s) 58, 79, 100
BseBI CCWGG 1 cut(s) 137
BseDI CCNNGG 2 cut(s) 66, 136
BseLI CCNNNNNNNGG 3 cut(s) 58, 79, 100
BsiHKAI GWGCWC 2 cut(s) 135, 149
BsiSI CCGG 1 cut(s) 59
BslI CCNNNNNNNGG 3 cut(s) 58, 79, 100
Bsp1286I GDGCHC 2 cut(s) 135, 149
BssECI CCNNGG 2 cut(s) 66, 136
BssT1I CCWWGG 1 cut(s) 66
Bst2UI CCWGG 1 cut(s) 137
BstDEI CTNAG 1 cut(s) 95
BstMWI GCNNNNNNNGC 1 cut(s) 130
BstNI CCWGG 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 135
Cfr13I GGNCC 1 cut(s) 70
CviAII CATG 1 cut(s) 106
CviJI RGCY 3 cut(s) 58, 133, 147
CviKI_1 RGCY 3 cut(s) 58, 133, 147
DdeI CTNAG 1 cut(s) 95
Ecl136II GAGCTC 2 cut(s) 133, 147
Eco130I CCWWGG 1 cut(s) 66
Eco24I GRGCYC 2 cut(s) 135, 149
Eco47I GGWCC 1 cut(s) 70
Eco53kI GAGCTC 2 cut(s) 133, 147
EcoICRI GAGCTC 2 cut(s) 133, 147
EcoRII CCWGG 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 66
EcoT22I ATGCAT 1 cut(s) 6
EcoT38I GRGCYC 2 cut(s) 135, 149
ErhI CCWWGG 1 cut(s) 66
FaeI CATG 1 cut(s) 109
FaiI YATR 3 cut(s) 6, 107, 151
FatI CATG 1 cut(s) 105
FriOI GRGCYC 2 cut(s) 135, 149
HapII CCGG 1 cut(s) 59
Hin1II CATG 1 cut(s) 109
HinfI GANTC 1 cut(s) 83
HpaII CCGG 1 cut(s) 59
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 130
HpyF3I CTNAG 1 cut(s) 95
Hsp92II CATG 1 cut(s) 109
LmnI GCTCC 2 cut(s) 138, 144
LpnPI CCDG 4 cut(s) 65, 72, 122, 149
MboII GAAGA 1 cut(s) 58
MhlI GDGCHC 2 cut(s) 135, 149
MluCI AATT 1 cut(s) 77
MlyI GAGTC 1 cut(s) 77
MmeI TCCRAC 1 cut(s) 111
MnlI CCTC 4 cut(s) 11, 20, 102, 135
Mph1103I ATGCAT 1 cut(s) 6
MspI CCGG 1 cut(s) 59
MspR9I CCNGG 1 cut(s) 137
MvaI CCWGG 1 cut(s) 137
MwoI GCNNNNNNNGC 1 cut(s) 130
NlaIII CATG 1 cut(s) 109
NsiI ATGCAT 1 cut(s) 6
PflMI CCANNNNNTGG 1 cut(s) 79
PleI GAGTC 1 cut(s) 77
PpsI GAGTC 1 cut(s) 77
Psp124BI GAGCTC 2 cut(s) 135, 149
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PspPI GGNCC 1 cut(s) 70
SacI GAGCTC 2 cut(s) 135, 149
Sau96I GGNCC 1 cut(s) 70
SchI GAGTC 1 cut(s) 77
ScrFI CCNGG 1 cut(s) 137
SduI GDGCHC 2 cut(s) 135, 149
SetI ASST 3 cut(s) 96, 135, 149
SgeI CNNG 9 cut(s) 25, 64, 71, 79, 86, 118, 133, 148, 149
SinI GGWCC 1 cut(s) 70
Sse9I AATT 1 cut(s) 77
SstI GAGCTC 2 cut(s) 135, 149
StyD4I CCNGG 1 cut(s) 135
StyI CCWWGG 1 cut(s) 66
TasI AATT 1 cut(s) 77
TspGWI ACGGA 1 cut(s) 39
Van91I CCANNNNNTGG 1 cut(s) 79
VpaK11BI GGWCC 1 cut(s) 70
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.