Rh4BG131500

Domain of unknown function (DUF4602)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Forward (+)
22074316 .. 22075057
742 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG131500.1

Sequence Viewer

Length: 168 bp
ATGCATAAGAATAAGGGAGGCGACAGAGGGCGACAAATGGGTAGGAAGAACCAGAAGCCGGAAACCAAGGACCAAGAATTGGACTCCAACGACCTAAGAATGGACATGAGGGAGATTTCCAAGCGTATTGAGCTCTTGGGTCTATCCTGGCATTTGGTGAACTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.5

Weight (kDa)

9.69

Isoelectric Point (pI)

61.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024955)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0391011
rosa_roxburghii Rroxscaffold_2G00131540
rosa_samantha Rh4BG131500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 79
AfiI CCNNNNNNNGG 3 cut(s) 58, 79, 100
AjnI CCWGG 1 cut(s) 146
AluBI AGCT 1 cut(s) 133
AluI AGCT 1 cut(s) 133
Alw21I GWGCWC 1 cut(s) 135
AspS9I GGNCC 1 cut(s) 70
AvaII GGWCC 1 cut(s) 70
BanII GRGCYC 1 cut(s) 135
Bbv12I GWGCWC 1 cut(s) 135
BciT130I CCWGG 1 cut(s) 148
Bme1390I CCNGG 1 cut(s) 148
Bme18I GGWCC 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 70
BmrFI CCNGG 1 cut(s) 148
BsaJI CCNNGG 1 cut(s) 66
Bsc4I CCNNNNNNNGG 3 cut(s) 58, 79, 100
BseBI CCWGG 1 cut(s) 148
BseDI CCNNGG 1 cut(s) 66
BseLI CCNNNNNNNGG 3 cut(s) 58, 79, 100
BsiHKAI GWGCWC 1 cut(s) 135
BsiSI CCGG 1 cut(s) 59
BslI CCNNNNNNNGG 3 cut(s) 58, 79, 100
Bsp1286I GDGCHC 1 cut(s) 135
BssECI CCNNGG 1 cut(s) 66
BssT1I CCWWGG 1 cut(s) 66
Bst2UI CCWGG 1 cut(s) 148
BstDEI CTNAG 1 cut(s) 95
BstMWI GCNNNNNNNGC 1 cut(s) 130
BstNI CCWGG 1 cut(s) 148
BstSCI CCNGG 1 cut(s) 146
Cfr13I GGNCC 1 cut(s) 70
CviAII CATG 1 cut(s) 106
CviJI RGCY 2 cut(s) 58, 133
CviKI_1 RGCY 2 cut(s) 58, 133
DdeI CTNAG 1 cut(s) 95
Ecl136II GAGCTC 1 cut(s) 133
Eco130I CCWWGG 1 cut(s) 66
Eco24I GRGCYC 1 cut(s) 135
Eco47I GGWCC 1 cut(s) 70
Eco53kI GAGCTC 1 cut(s) 133
EcoICRI GAGCTC 1 cut(s) 133
EcoRII CCWGG 1 cut(s) 146
EcoT14I CCWWGG 1 cut(s) 66
EcoT22I ATGCAT 1 cut(s) 6
EcoT38I GRGCYC 1 cut(s) 135
ErhI CCWWGG 1 cut(s) 66
FaeI CATG 1 cut(s) 109
FaiI YATR 3 cut(s) 6, 107, 166
FatI CATG 1 cut(s) 105
FriOI GRGCYC 1 cut(s) 135
HapII CCGG 1 cut(s) 59
Hin1II CATG 1 cut(s) 109
HinfI GANTC 1 cut(s) 83
HpaII CCGG 1 cut(s) 59
Hpy166II GTNNAC 1 cut(s) 160
Hpy8I GTNNAC 1 cut(s) 160
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 130
HpyF3I CTNAG 1 cut(s) 95
Hsp92II CATG 1 cut(s) 109
LpnPI CCDG 4 cut(s) 65, 72, 133, 160
MboII GAAGA 1 cut(s) 58
MhlI GDGCHC 1 cut(s) 135
MluCI AATT 1 cut(s) 77
MlyI GAGTC 1 cut(s) 77
MmeI TCCRAC 1 cut(s) 111
MnlI CCTC 3 cut(s) 11, 20, 102
Mph1103I ATGCAT 1 cut(s) 6
MspI CCGG 1 cut(s) 59
MspR9I CCNGG 1 cut(s) 148
MvaI CCWGG 1 cut(s) 148
MwoI GCNNNNNNNGC 1 cut(s) 130
NlaIII CATG 1 cut(s) 109
NsiI ATGCAT 1 cut(s) 6
PflMI CCANNNNNTGG 1 cut(s) 79
PleI GAGTC 1 cut(s) 77
PpsI GAGTC 1 cut(s) 77
Psp124BI GAGCTC 1 cut(s) 135
Psp6I CCWGG 1 cut(s) 146
PspGI CCWGG 1 cut(s) 146
PspPI GGNCC 1 cut(s) 70
SacI GAGCTC 1 cut(s) 135
Sau96I GGNCC 1 cut(s) 70
SchI GAGTC 1 cut(s) 77
ScrFI CCNGG 1 cut(s) 148
SduI GDGCHC 1 cut(s) 135
SetI ASST 2 cut(s) 96, 135
SgeI CNNG 9 cut(s) 64, 71, 79, 86, 118, 133, 148, 159, 160
SinI GGWCC 1 cut(s) 70
Sse9I AATT 1 cut(s) 77
SstI GAGCTC 1 cut(s) 135
StyD4I CCNGG 1 cut(s) 146
StyI CCWWGG 1 cut(s) 66
TasI AATT 1 cut(s) 77
Van91I CCANNNNNTGG 1 cut(s) 79
VpaK11BI GGWCC 1 cut(s) 70
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.