Rroxscaffold_4G00316530

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
41482382 .. 41484497
2116 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00316530.1

Sequence Viewer

Length: 201 bp
ATGGGGGATTATTGCACATTGACAGGATCACCGAGAACACAACACCAGCAACTACCTTCAAGAAGACCTGTCTGTACTACATTTGGTCATCATAGCCATGTAAGTATAGTCATGAAATTACATATAGCTAGGCTTTTATACATACTACTAATCTCTGTTTTTAATGGATTACTGAAATTTTTGTTTCCCTTTGGTTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.51

Weight (kDa)

10.05

Isoelectric Point (pI)

60.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021315)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0331411 RchiOBHm_Chr2g0132061
rosa_roxburghii Rroxscaffold_4G00316530
rosa_samantha Rh5AG156700 Rh5DG156500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 34
AcsI RAATTY 1 cut(s) 176
AfaI GTAC 1 cut(s) 76
AgsI TTSAA 1 cut(s) 60
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
AlwI GGATC 1 cut(s) 34
ApoI RAATTY 1 cut(s) 176
AsuHPI GGTGA 1 cut(s) 21
BbsI GAAGAC 1 cut(s) 70
BfaI CTAG 1 cut(s) 129
BpiI GAAGAC 1 cut(s) 70
Bsp143I GATC 1 cut(s) 26
BspHI TCATGA 1 cut(s) 111
BspPI GGATC 1 cut(s) 34
BssMI GATC 1 cut(s) 26
BstKTI GATC 1 cut(s) 29
BstMBI GATC 1 cut(s) 26
BstV2I GAAGAC 1 cut(s) 70
CciI TCATGA 1 cut(s) 111
Csp6I GTAC 1 cut(s) 75
CviAII CATG 2 cut(s) 98, 112
CviJI RGCY 3 cut(s) 96, 128, 133
CviKI_1 RGCY 3 cut(s) 96, 128, 133
CviQI GTAC 1 cut(s) 75
DpnI GATC 1 cut(s) 28
DpnII GATC 1 cut(s) 26
FaeI CATG 2 cut(s) 101, 115
FaiI YATR 9 cut(s) 93, 99, 107, 113, 123, 125, 139, 143, 199
FatI CATG 2 cut(s) 97, 111
FspBI CTAG 1 cut(s) 129
Hin1II CATG 2 cut(s) 101, 115
HphI GGTGA 1 cut(s) 21
Hpy188III TCNNGA 2 cut(s) 60, 112
HpyAV CCTTC 1 cut(s) 66
HpyCH4V TGCA 1 cut(s) 15
Hsp92II CATG 2 cut(s) 101, 115
Kzo9I GATC 1 cut(s) 26
LpnPI CCDG 3 cut(s) 9, 59, 81
MaeI CTAG 1 cut(s) 129
MalI GATC 1 cut(s) 28
MboI GATC 1 cut(s) 26
MboII GAAGA 1 cut(s) 75
MluCI AATT 2 cut(s) 116, 176
MseI TTAA 1 cut(s) 162
MslI CAYNNNNRTG 1 cut(s) 96
NdeII GATC 1 cut(s) 26
NlaIII CATG 2 cut(s) 101, 115
PagI TCATGA 1 cut(s) 111
RsaI GTAC 1 cut(s) 76
RsaNI GTAC 1 cut(s) 75
RseI CAYNNNNRTG 1 cut(s) 96
SaqAI TTAA 1 cut(s) 162
Sau3AI GATC 1 cut(s) 26
SetI ASST 3 cut(s) 58, 70, 130
SgeI CNNG 8 cut(s) 36, 45, 58, 72, 80, 110, 124, 141
SmiMI CAYNNNNRTG 1 cut(s) 96
Sse9I AATT 2 cut(s) 116, 176
SspMI CTAG 1 cut(s) 129
TasI AATT 2 cut(s) 116, 176
TatI WGTACW 1 cut(s) 74
Tru1I TTAA 1 cut(s) 162
Tru9I TTAA 1 cut(s) 162
TspDTI ATGAA 1 cut(s) 128
XapI RAATTY 1 cut(s) 176
XspI CTAG 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.