Rh5AG156700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
16484154 .. 16490339
6186 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG156700.1

Sequence Viewer

Length: 264 bp
ATGAACTCCAACTTGGCCTTGACGCCTGCTACCAGAGGTGAATTGCTTGAAGCCTTGAATGCCATTACTATTAGCAATCGTTCTCATCGCACGGGATATATACAACGAGGATTCAAACAGTTTGGGATCACGATTGTCAAGGGTCCTGTCAGGAAGGCAAAGAAAAAGAAGCTTCAGCATGCACGGAAGACCATGGGGGATTATTGCACATTGACAGGATCACCGACAACAGAAAACAACTTCTTCAAATTGAAGCAATGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.74

Weight (kDa)

10.46

Isoelectric Point (pI)

20.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021315)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0331411 RchiOBHm_Chr2g0132061
rosa_roxburghii Rroxscaffold_4G00316530
rosa_samantha Rh5AG156700 Rh5DG156500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 134, 226
AcuI CTGAAG 1 cut(s) 158
AcyI GRCGYC 1 cut(s) 23
AgsI TTSAA 5 cut(s) 50, 58, 115, 247, 253
AjuI GAANNNNNNNTTGG 1 cut(s) 28
AluBI AGCT 1 cut(s) 172
AluI AGCT 1 cut(s) 172
AlwI GGATC 2 cut(s) 134, 226
AoxI GGCC 1 cut(s) 15
AspS9I GGNCC 1 cut(s) 143
AsuHPI GGTGA 2 cut(s) 50, 213
AvaII GGWCC 1 cut(s) 143
BbsI GAAGAC 1 cut(s) 194
Bme18I GGWCC 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 143
BmiI GGNNCC 1 cut(s) 144
BpiI GAAGAC 1 cut(s) 194
BsaHI GRCGYC 1 cut(s) 23
BsaJI CCNNGG 1 cut(s) 192
Bse3DI GCAATG 1 cut(s) 263
BseDI CCNNGG 1 cut(s) 192
BseMI GCAATG 1 cut(s) 263
BshFI GGCC 1 cut(s) 17
BsmI GAATGC 1 cut(s) 64
BsnI GGCC 1 cut(s) 17
Bsp143I GATC 2 cut(s) 126, 218
Bsp19I CCATGG 1 cut(s) 192
BspANI GGCC 1 cut(s) 17
BspLI GGNNCC 1 cut(s) 144
BspPI GGATC 2 cut(s) 134, 226
BsrDI GCAATG 1 cut(s) 263
BssECI CCNNGG 1 cut(s) 192
BssMI GATC 2 cut(s) 126, 218
BssNI GRCGYC 1 cut(s) 23
BssT1I CCWWGG 1 cut(s) 192
Bst4CI ACNGT 1 cut(s) 120
BstACI GRCGYC 1 cut(s) 23
BstC8I GCNNGC 2 cut(s) 27, 180
BstDSI CCRYGG 1 cut(s) 192
BstKTI GATC 2 cut(s) 129, 221
BstMBI GATC 2 cut(s) 126, 218
BstMWI GCNNNNNNNGC 1 cut(s) 59
BstNSI RCATGY 1 cut(s) 182
BstV2I GAAGAC 1 cut(s) 194
BsuRI GGCC 1 cut(s) 17
BtgI CCRYGG 1 cut(s) 192
BtgZI GCGATG 1 cut(s) 71
Cac8I GCNNGC 2 cut(s) 27, 180
Cfr13I GGNCC 1 cut(s) 143
CseI GACGC 1 cut(s) 31
CviAII CATG 2 cut(s) 179, 193
CviJI RGCY 3 cut(s) 17, 53, 172
CviKI_1 RGCY 3 cut(s) 17, 53, 172
DpnI GATC 2 cut(s) 128, 220
DpnII GATC 2 cut(s) 126, 218
Eco130I CCWWGG 1 cut(s) 192
Eco47I GGWCC 1 cut(s) 143
Eco57I CTGAAG 1 cut(s) 158
EcoO109I RGGNCCY 1 cut(s) 143
EcoT14I CCWWGG 1 cut(s) 192
ErhI CCWWGG 1 cut(s) 192
FaeI CATG 2 cut(s) 182, 196
FaiI YATR 4 cut(s) 99, 101, 180, 194
FatI CATG 2 cut(s) 178, 192
HaeIII GGCC 1 cut(s) 17
HgaI GACGC 1 cut(s) 31
Hin1I GRCGYC 1 cut(s) 23
Hin1II CATG 2 cut(s) 182, 196
HindIII AAGCTT 1 cut(s) 170
HinfI GANTC 1 cut(s) 111
HphI GGTGA 2 cut(s) 50, 213
Hpy188III TCNNGA 2 cut(s) 130, 151
HpyAV CCTTC 1 cut(s) 148
HpyCH4III ACNGT 1 cut(s) 120
HpyCH4V TGCA 2 cut(s) 182, 207
HpyF10VI GCNNNNNNNGC 1 cut(s) 59
Hsp92I GRCGYC 1 cut(s) 23
Hsp92II CATG 2 cut(s) 182, 196
Kzo9I GATC 2 cut(s) 126, 218
LpnPI CCDG 5 cut(s) 39, 46, 136, 159, 201
MalI GATC 2 cut(s) 128, 220
MboI GATC 2 cut(s) 126, 218
MboII GAAGA 2 cut(s) 199, 235
MluCI AATT 2 cut(s) 41, 248
MmeI TCCRAC 1 cut(s) 33
MnlI CCTC 2 cut(s) 29, 101
Mva1269I GAATGC 1 cut(s) 64
MwoI GCNNNNNNNGC 1 cut(s) 59
NcoI CCATGG 1 cut(s) 192
NdeII GATC 2 cut(s) 126, 218
NlaIII CATG 2 cut(s) 182, 196
NlaIV GGNNCC 1 cut(s) 144
NspI RCATGY 1 cut(s) 182
PaeI GCATGC 1 cut(s) 182
PctI GAATGC 1 cut(s) 64
PfeI GAWTC 1 cut(s) 111
PpuMI RGGWCCY 1 cut(s) 143
Psp5II RGGWCCY 1 cut(s) 143
PspN4I GGNNCC 1 cut(s) 144
PspPI GGNCC 1 cut(s) 143
PspPPI RGGWCCY 1 cut(s) 143
Sau3AI GATC 2 cut(s) 126, 218
Sau96I GGNCC 1 cut(s) 143
SetI ASST 2 cut(s) 40, 174
SinI GGWCC 1 cut(s) 143
SphI GCATGC 1 cut(s) 182
Sse9I AATT 2 cut(s) 41, 248
StyI CCWWGG 1 cut(s) 192
TaaI ACNGT 1 cut(s) 120
TasI AATT 2 cut(s) 41, 248
TfiI GAWTC 1 cut(s) 111
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 199
VpaK11BI GGWCC 1 cut(s) 143
XceI RCATGY 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.