Rroxscaffold_5G00383200

Leucine rich repeat

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
62871900 .. 62872794
895 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00383200.1

Sequence Viewer

Length: 174 bp
ATGGGAAGACATCCTGGAGAACTGATTTTCTTGACTGCAACATCTTCCTTGATGTCGACAAAGTCACCCCTGGTTTTACAAATTATGCTGAAAGATGTGTTGGAACCACGCCTATCTCCTCCCAGCATTCAACCGGTAGCTTCTAGTGTGTTTATGATAGCCACATTAGCCTAG

Protein Analysis

57

Amino Acids

6.12

Weight (kDa)

8.37

Isoelectric Point (pI)

61.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024954)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0442341
rosa_roxburghii Rroxscaffold_5G00383200
rosa_rugosa Rorug04G0340500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 56
AgeI ACCGGT 1 cut(s) 133
AgsI TTSAA 1 cut(s) 131
AjnI CCWGG 2 cut(s) 13, 69
AjuI GAANNNNNNNTTGG 2 cut(s) 83, 115
AluBI AGCT 1 cut(s) 140
AluI AGCT 1 cut(s) 140
AsiGI ACCGGT 1 cut(s) 133
AsuHPI GGTGA 1 cut(s) 57
BbsI GAAGAC 1 cut(s) 13
BciT130I CCWGG 2 cut(s) 15, 71
BfaI CTAG 2 cut(s) 144, 172
Bme1390I CCNGG 2 cut(s) 15, 71
BmiI GGNNCC 1 cut(s) 105
BmrFI CCNGG 2 cut(s) 15, 71
BpiI GAAGAC 1 cut(s) 13
BpmI CTGGAG 1 cut(s) 36
BsaJI CCNNGG 1 cut(s) 69
BsaWI WCCGGW 1 cut(s) 133
Bse118I RCCGGY 1 cut(s) 133
BseBI CCWGG 2 cut(s) 15, 71
BseDI CCNNGG 1 cut(s) 69
BseGI GGATG 1 cut(s) 10
BseRI GAGGAG 1 cut(s) 108
BseYI CCCAGC 1 cut(s) 122
BshTI ACCGGT 1 cut(s) 133
BsiSI CCGG 1 cut(s) 134
BsmI GAATGC 1 cut(s) 126
BspLI GGNNCC 1 cut(s) 105
BsrFI RCCGGY 1 cut(s) 133
BssAI RCCGGY 1 cut(s) 133
BssECI CCNNGG 1 cut(s) 69
Bst2UI CCWGG 2 cut(s) 15, 71
BstF5I GGATG 1 cut(s) 10
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstNI CCWGG 2 cut(s) 15, 71
BstSCI CCNGG 2 cut(s) 13, 69
BstV2I GAAGAC 1 cut(s) 13
BtsCI GGATG 1 cut(s) 10
Cfr10I RCCGGY 1 cut(s) 133
CspAI ACCGGT 1 cut(s) 133
CviJI RGCY 3 cut(s) 140, 161, 170
CviKI_1 RGCY 3 cut(s) 140, 161, 170
EcoRII CCWGG 2 cut(s) 13, 69
FaiI YATR 2 cut(s) 86, 155
FblI GTMKAC 1 cut(s) 56
FspBI CTAG 2 cut(s) 144, 172
GsaI CCCAGC 1 cut(s) 126
GsuI CTGGAG 1 cut(s) 36
HapII CCGG 1 cut(s) 134
HincII GTYRAC 1 cut(s) 57
HindII GTYRAC 1 cut(s) 57
HpaII CCGG 1 cut(s) 134
HphI GGTGA 1 cut(s) 57
Hpy166II GTNNAC 1 cut(s) 57
Hpy188III TCNNGA 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 57
HpyCH4V TGCA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
LpnPI CCDG 5 cut(s) 27, 56, 83, 136, 147
MaeI CTAG 2 cut(s) 144, 172
MaeIII GTNAC 1 cut(s) 63
MboII GAAGA 2 cut(s) 18, 36
MluCI AATT 1 cut(s) 81
MmeI TCCRAC 1 cut(s) 81
MnlI CCTC 1 cut(s) 129
MspI CCGG 1 cut(s) 134
MspR9I CCNGG 2 cut(s) 15, 71
Mva1269I GAATGC 1 cut(s) 126
MvaI CCWGG 2 cut(s) 15, 71
MwoI GCNNNNNNNGC 1 cut(s) 167
NlaIV GGNNCC 1 cut(s) 105
NmuCI GTSAC 1 cut(s) 63
PctI GAATGC 1 cut(s) 126
PflFI GACNNNGTC 1 cut(s) 61
PfoI TCCNGGA 1 cut(s) 13
PinAI ACCGGT 1 cut(s) 133
Psp6I CCWGG 2 cut(s) 13, 69
PspFI CCCAGC 1 cut(s) 122
PspGI CCWGG 2 cut(s) 13, 69
PspN4I GGNNCC 1 cut(s) 105
PsyI GACNNNGTC 1 cut(s) 61
SalI GTCGAC 1 cut(s) 55
ScrFI CCNGG 2 cut(s) 15, 71
SetI ASST 1 cut(s) 142
Sse9I AATT 1 cut(s) 81
SspMI CTAG 2 cut(s) 144, 172
StyD4I CCNGG 2 cut(s) 13, 69
TaqI TCGA 1 cut(s) 56
TasI AATT 1 cut(s) 81
TseFI GTSAC 1 cut(s) 63
Tsp45I GTSAC 1 cut(s) 63
Tth111I GACNNNGTC 1 cut(s) 61
XmiI GTMKAC 1 cut(s) 56
XspI CTAG 2 cut(s) 144, 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.