Rroxscaffold_6G00401300

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
OG0024898
Physical Location & Seq
Forward (+)
23649069 .. 23650000
932 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00401300.1

Sequence Viewer

Length: 333 bp
ATGAGTGTGCAAATAGACAATATGGGTATGCAAATAGGGGATTTGTATACGAATCAAGATACTATTGTAGAGATGATCAGGGATATGCGACAGAATGGCCTTGTGCAAAATAAAGTTAAAGTCGGGTGGTTTGGAGTACCTGAACCGCCATCATTTACAGTGGGATTGGATTTACATTTGGATGATTTGAAGAAGAAACTTCTTGAGGATGGGGTGTCAATGGCTCTGGTCACTGGTCATCCAGGCTCTGGAAAAACCACATTGGCAAAAGCTTTTTGTCAAGATAAGAAAGTGAAAGACAAATTCAAGAGCATCATCTTTGTCGATGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04014 map04014
Pfam Domains
Protein Families
NB-ARC RPW8

Protein Analysis

110

Amino Acids

12.21

Weight (kDa)

6.71

Isoelectric Point (pI)

12.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NB-ARC PF00931 59 - 110 1.6e-07 NB-ARC domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024898)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0480501
rosa_roxburghii Rroxscaffold_6G00401300
rosa_samantha Rh3AG235700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 248
AccI GTMKAC 1 cut(s) 47
AciI CCGC 1 cut(s) 146
AcsI RAATTY 1 cut(s) 302
AfaI GTAC 1 cut(s) 138
AfiI CCNNNNNNNGG 1 cut(s) 248
AgsI TTSAA 2 cut(s) 190, 307
AjnI CCWGG 1 cut(s) 241
AluBI AGCT 1 cut(s) 272
AluI AGCT 1 cut(s) 272
AlwNI CAGNNNCTG 1 cut(s) 248
AoxI GGCC 1 cut(s) 97
ApoI RAATTY 1 cut(s) 302
BaeI ACNNNNGTAYC 2 cut(s) 51, 84
BccI CCATC 2 cut(s) 157, 203
BciT130I CCWGG 1 cut(s) 243
BclI TGATCA 1 cut(s) 75
Bme1390I CCNGG 1 cut(s) 243
BmrFI CCNGG 1 cut(s) 243
BmsI GCATC 1 cut(s) 321
BpuEI CTTGAG 1 cut(s) 224
Bsc4I CCNNNNNNNGG 1 cut(s) 248
Bse1I ACTGG 1 cut(s) 238
BseBI CCWGG 1 cut(s) 243
BseGI GGATG 3 cut(s) 187, 214, 238
BseLI CCNNNNNNNGG 1 cut(s) 248
BseNI ACTGG 1 cut(s) 238
BshFI GGCC 1 cut(s) 99
BslI CCNNNNNNNGG 1 cut(s) 248
BsnI GGCC 1 cut(s) 99
Bsp143I GATC 1 cut(s) 75
BspACI CCGC 1 cut(s) 146
BspANI GGCC 1 cut(s) 99
BsrI ACTGG 1 cut(s) 238
BssMI GATC 1 cut(s) 75
BssNAI GTATAC 1 cut(s) 48
Bst1107I GTATAC 1 cut(s) 48
Bst2UI CCWGG 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 160
BstF5I GGATG 3 cut(s) 187, 214, 238
BstKTI GATC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BstNI CCWGG 1 cut(s) 243
BstSCI CCNGG 1 cut(s) 241
BstZ17I GTATAC 1 cut(s) 48
BsuRI GGCC 1 cut(s) 99
BtsCI GGATG 3 cut(s) 187, 214, 238
BtsIMutI CAGTG 2 cut(s) 165, 231
CaiI CAGNNNCTG 1 cut(s) 248
Csp6I GTAC 1 cut(s) 137
CviJI RGCY 4 cut(s) 99, 224, 246, 272
CviKI_1 RGCY 4 cut(s) 99, 224, 246, 272
CviQI GTAC 1 cut(s) 137
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
EcoRII CCWGG 1 cut(s) 241
FaiI YATR 4 cut(s) 23, 29, 48, 86
FbaI TGATCA 1 cut(s) 75
FblI GTMKAC 1 cut(s) 47
FokI GGATG 3 cut(s) 194, 221, 225
HaeIII GGCC 1 cut(s) 99
HindIII AAGCTT 1 cut(s) 270
HinfI GANTC 1 cut(s) 52
Hpy166II GTNNAC 1 cut(s) 48
Hpy188III TCNNGA 5 cut(s) 56, 203, 249, 281, 307
Hpy8I GTNNAC 1 cut(s) 48
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4V TGCA 3 cut(s) 10, 31, 106
Ksp22I TGATCA 1 cut(s) 75
Kzo9I GATC 1 cut(s) 75
LpnPI CCDG 7 cut(s) 64, 153, 212, 219, 228, 234, 255
LweI GCATC 1 cut(s) 321
MaeIII GTNAC 1 cut(s) 229
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MboII GAAGA 2 cut(s) 202, 205
MluCI AATT 1 cut(s) 302
MnlI CCTC 1 cut(s) 199
MseI TTAA 1 cut(s) 117
MslI CAYNNNNRTG 1 cut(s) 180
MspR9I CCNGG 1 cut(s) 243
MvaI CCWGG 1 cut(s) 243
NdeII GATC 1 cut(s) 75
NmuCI GTSAC 1 cut(s) 229
PfeI GAWTC 1 cut(s) 52
PflMI CCANNNNNTGG 1 cut(s) 248
Psp6I CCWGG 1 cut(s) 241
PspGI CCWGG 1 cut(s) 241
PstNI CAGNNNCTG 1 cut(s) 248
RsaI GTAC 1 cut(s) 138
RsaNI GTAC 1 cut(s) 137
RseI CAYNNNNRTG 1 cut(s) 180
SaqAI TTAA 1 cut(s) 117
Sau3AI GATC 1 cut(s) 75
ScrFI CCNGG 1 cut(s) 243
SetI ASST 2 cut(s) 142, 274
SfaNI GCATC 1 cut(s) 321
SmiMI CAYNNNNRTG 1 cut(s) 180
SmlI CTYRAG 1 cut(s) 203
SmoI CTYRAG 1 cut(s) 203
Sse9I AATT 1 cut(s) 302
SsiI CCGC 1 cut(s) 146
StyD4I CCNGG 1 cut(s) 241
TaaI ACNGT 1 cut(s) 160
TaqI TCGA 1 cut(s) 324
TasI AATT 1 cut(s) 302
TfiI GAWTC 1 cut(s) 52
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TscAI CASTG 2 cut(s) 165, 238
TseFI GTSAC 1 cut(s) 229
Tsp45I GTSAC 1 cut(s) 229
TspRI CASTG 2 cut(s) 165, 238
Van91I CCANNNNNTGG 1 cut(s) 248
XapI RAATTY 1 cut(s) 302
XmiI GTMKAC 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.