Rh3AG235700

disease resistance

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0024898
Physical Location & Seq
Reverse (-)
24343806 .. 24344537
732 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG235700.1

Sequence Viewer

Length: 432 bp
ATGGGGAGTATGAGTATGCAAATAGACAATATGGGTATGCAAATAGGGGATTTGTATACGAATCAAGATACTATTGTAGAGATGATCAGGGATATGCGACAGAATGGCCTAGTGCAAAATCAAGTTAAAGTTGGGTGGTTTGGAGTACCTGAACCGCCATCATTTACAGTGGGATTGGATTTACATTTGGATGATTTGAAGAACAAACTTCTTGAGGACGGGGTGTCAATGGCTCTGGTCACTGGTCATCCAGGCTCTGGGAAAACCACTTTGGCAAAAGCTTTTTCTCAAGATAAGAAAGTGAAAGACAAATTCAAGAGCATCATCTTTGTCAACGTTTCAAAAAGACCCAACACCGAGGTTGTACAGGAAATATGTGAAAAAAAAGGGTACCCGAATACTTTCTTTCCAATCCGAAGAAATTGCACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04014 map04014
Pfam Domains
Protein Families
NB-ARC RPW8

Protein Analysis

143

Amino Acids

16.03

Weight (kDa)

8.55

Isoelectric Point (pI)

29.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NB-ARC PF00931 62 - 126 1.7e-10 NB-ARC domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024898)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0480501
rosa_roxburghii Rroxscaffold_6G00401300
rosa_samantha Rh3AG235700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 390
AccB1I GGYRCC 1 cut(s) 390
AccB7I CCANNNNNTGG 1 cut(s) 257
AccI GTMKAC 1 cut(s) 56
AciI CCGC 1 cut(s) 155
AclI AACGTT 1 cut(s) 336
AcsI RAATTY 1 cut(s) 311
AfaI GTAC 3 cut(s) 147, 366, 392
AfiI CCNNNNNNNGG 1 cut(s) 257
AgsI TTSAA 3 cut(s) 199, 316, 342
AhdI GACNNNNNGTC 1 cut(s) 223
AjnI CCWGG 1 cut(s) 250
AjuI GAANNNNNNNTTGG 2 cut(s) 254, 286
AluBI AGCT 1 cut(s) 281
AluI AGCT 1 cut(s) 281
AlwNI CAGNNNCTG 1 cut(s) 257
AoxI GGCC 1 cut(s) 106
ApoI RAATTY 1 cut(s) 311
Asp700I GAANNNNTTC 1 cut(s) 401
Asp718I GGTACC 1 cut(s) 390
BaeI ACNNNNGTAYC 2 cut(s) 60, 93
BanI GGYRCC 1 cut(s) 390
BccI CCATC 1 cut(s) 166
BcgI CGANNNNNNTGC 1 cut(s) 405
BciT130I CCWGG 1 cut(s) 252
BclI TGATCA 1 cut(s) 84
BfaI CTAG 1 cut(s) 110
Bme1390I CCNGG 1 cut(s) 252
BmeRI GACNNNNNGTC 1 cut(s) 223
BmiI GGNNCC 1 cut(s) 392
BmrFI CCNGG 1 cut(s) 252
BmsI GCATC 1 cut(s) 330
BpuEI CTTGAG 2 cut(s) 233, 273
BsaJI CCNNGG 1 cut(s) 357
BsaXI ACNNNNNCTCC 1 cut(s) 28
Bsc4I CCNNNNNNNGG 1 cut(s) 257
Bse1I ACTGG 1 cut(s) 247
BseBI CCWGG 1 cut(s) 252
BseDI CCNNGG 1 cut(s) 357
BseGI GGATG 2 cut(s) 196, 247
BseLI CCNNNNNNNGG 1 cut(s) 257
BseNI ACTGG 1 cut(s) 247
BshFI GGCC 1 cut(s) 108
BshNI GGYRCC 1 cut(s) 390
BslI CCNNNNNNNGG 1 cut(s) 257
BsnI GGCC 1 cut(s) 108
Bsp1407I TGTACA 1 cut(s) 364
Bsp143I GATC 1 cut(s) 84
BspACI CCGC 1 cut(s) 155
BspANI GGCC 1 cut(s) 108
BspLI GGNNCC 1 cut(s) 392
BspT107I GGYRCC 1 cut(s) 390
BsrGI TGTACA 1 cut(s) 364
BsrI ACTGG 1 cut(s) 247
BssECI CCNNGG 1 cut(s) 357
BssMI GATC 1 cut(s) 84
BssNAI GTATAC 1 cut(s) 57
Bst1107I GTATAC 1 cut(s) 57
Bst2UI CCWGG 1 cut(s) 252
Bst4CI ACNGT 1 cut(s) 169
BstAUI TGTACA 1 cut(s) 364
BstF5I GGATG 2 cut(s) 196, 247
BstKTI GATC 1 cut(s) 87
BstMBI GATC 1 cut(s) 84
BstNI CCWGG 1 cut(s) 252
BstSCI CCNGG 1 cut(s) 250
BstZ17I GTATAC 1 cut(s) 57
BsuRI GGCC 1 cut(s) 108
BtsCI GGATG 2 cut(s) 196, 247
BtsIMutI CAGTG 2 cut(s) 174, 240
CaiI CAGNNNCTG 1 cut(s) 257
Csp6I GTAC 3 cut(s) 146, 365, 391
CviJI RGCY 4 cut(s) 108, 233, 255, 281
CviKI_1 RGCY 4 cut(s) 108, 233, 255, 281
CviQI GTAC 3 cut(s) 146, 365, 391
DpnI GATC 1 cut(s) 86
DpnII GATC 1 cut(s) 84
DriI GACNNNNNGTC 1 cut(s) 223
Eam1105I GACNNNNNGTC 1 cut(s) 223
EcoRII CCWGG 1 cut(s) 250
FaiI YATR 7 cut(s) 11, 17, 32, 38, 57, 95, 376
FbaI TGATCA 1 cut(s) 84
FblI GTMKAC 1 cut(s) 56
FokI GGATG 2 cut(s) 203, 234
FspBI CTAG 1 cut(s) 110
HaeIII GGCC 1 cut(s) 108
HincII GTYRAC 1 cut(s) 334
HindII GTYRAC 1 cut(s) 334
HindIII AAGCTT 1 cut(s) 279
HinfI GANTC 1 cut(s) 61
Hpy166II GTNNAC 2 cut(s) 57, 334
Hpy188I TCNGA 1 cut(s) 416
Hpy188III TCNNGA 4 cut(s) 65, 212, 290, 316
Hpy8I GTNNAC 2 cut(s) 57, 334
HpyCH4III ACNGT 1 cut(s) 169
HpyCH4IV ACGT 1 cut(s) 336
HpyCH4V TGCA 4 cut(s) 19, 40, 115, 426
HpySE526I ACGT 1 cut(s) 336
KpnI GGTACC 1 cut(s) 394
Ksp22I TGATCA 1 cut(s) 84
Kzo9I GATC 1 cut(s) 84
LpnPI CCDG 8 cut(s) 73, 162, 221, 228, 237, 243, 264, 353
LweI GCATC 1 cut(s) 330
MaeI CTAG 1 cut(s) 110
MaeII ACGT 1 cut(s) 336
MaeIII GTNAC 1 cut(s) 238
MalI GATC 1 cut(s) 86
MboI GATC 1 cut(s) 84
MboII GAAGA 2 cut(s) 211, 429
MluCI AATT 2 cut(s) 311, 421
MnlI CCTC 2 cut(s) 208, 352
MroXI GAANNNNTTC 1 cut(s) 401
MseI TTAA 1 cut(s) 126
MslI CAYNNNNRTG 1 cut(s) 189
MspR9I CCNGG 1 cut(s) 252
MvaI CCWGG 1 cut(s) 252
NdeII GATC 1 cut(s) 84
NlaIV GGNNCC 1 cut(s) 392
NmuCI GTSAC 1 cut(s) 238
PdmI GAANNNNTTC 1 cut(s) 401
PfeI GAWTC 1 cut(s) 61
PflMI CCANNNNNTGG 1 cut(s) 257
Psp1406I AACGTT 1 cut(s) 336
Psp6I CCWGG 1 cut(s) 250
PspGI CCWGG 1 cut(s) 250
PspN4I GGNNCC 1 cut(s) 392
PstNI CAGNNNCTG 1 cut(s) 257
RsaI GTAC 3 cut(s) 147, 366, 392
RsaNI GTAC 3 cut(s) 146, 365, 391
RseI CAYNNNNRTG 1 cut(s) 189
SaqAI TTAA 1 cut(s) 126
Sau3AI GATC 1 cut(s) 84
ScrFI CCNGG 1 cut(s) 252
SetI ASST 4 cut(s) 151, 283, 339, 363
SfaNI GCATC 1 cut(s) 330
SmiMI CAYNNNNRTG 1 cut(s) 189
SmlI CTYRAG 2 cut(s) 212, 288
SmoI CTYRAG 2 cut(s) 212, 288
Sse9I AATT 2 cut(s) 311, 421
SsiI CCGC 1 cut(s) 155
SspMI CTAG 1 cut(s) 110
StyD4I CCNGG 1 cut(s) 250
TaaI ACNGT 1 cut(s) 169
TaiI ACGT 1 cut(s) 339
TasI AATT 2 cut(s) 311, 421
TatI WGTACW 1 cut(s) 364
TfiI GAWTC 1 cut(s) 61
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TscAI CASTG 2 cut(s) 174, 247
TseFI GTSAC 1 cut(s) 238
Tsp45I GTSAC 1 cut(s) 238
TspRI CASTG 2 cut(s) 174, 247
Van91I CCANNNNNTGG 1 cut(s) 257
XapI RAATTY 1 cut(s) 311
XmiI GTMKAC 1 cut(s) 56
XmnI GAANNNNTTC 1 cut(s) 401
XspI CTAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.