Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000007

Orthogroup ID

OG0020582

Physical Location & Seq

Genomic Coordinates Reverse (-)

21945755 .. 21946046

Gene Structure 292 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_7G00182840.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 219 bp

ATGGCCGGCGAACGAATCAAGTTGCAAATCTGGGACACAGCCGGTCAGGAACGGTTCAAAACAATCACAAGAGGGGTTGGGGAGGAAAAGCACCCTCCTTCTGTAATTGTCAAGAAGATACTGGTGGGAAACAAGGCTGACATCGGTGAAAGCAAAAGGGCAGTGACGAAATCTAGAGGTCAGGCTCTTGCTGATGAGTTTGGCCTCAAGTTCTTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04144 ko04152 ko04530 ko04972 map04144 map04152 map04530 map04972

Pfam Domains

Protein Families

Ras

Protein Analysis

72

Amino Acids

7.98

Weight (kDa)

9.9

Isoelectric Point (pI)

21.05

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ras	PF00071	2 - 25	5.4e-07	Ras family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020582)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr6g0285671
rosa_multiflora	Rmu_sc0001989.1_g000010
rosa_roxburghii	Rroxscaffold_7G00182840
rosa_samantha	Rh6BG289600 Rh6CG290600 Rh6DG283300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	3
AgsI	TTSAA	1 cut(s)	58
AoxI	GGCC	2 cut(s)	3, 202
AsuHPI	GGTGA	1 cut(s)	158
BfaI	CTAG	1 cut(s)	174
BpuEI	CTTGAG	1 cut(s)	191
Bse118I	RCCGGY	2 cut(s)	5, 41
Bse1I	ACTGG	1 cut(s)	126
BseNI	ACTGG	1 cut(s)	126
BshFI	GGCC	2 cut(s)	5, 204
BsiSI	CCGG	2 cut(s)	6, 42
BslFI	GGGAC	1 cut(s)	47
BsmFI	GGGAC	1 cut(s)	47
BsnI	GGCC	2 cut(s)	5, 204
BspANI	GGCC	2 cut(s)	5, 204
BsrFI	RCCGGY	2 cut(s)	5, 41
BsrI	ACTGG	1 cut(s)	126
BssAI	RCCGGY	2 cut(s)	5, 41
Bst4CI	ACNGT	1 cut(s)	54
BstC8I	GCNNGC	1 cut(s)	7
BsuRI	GGCC	2 cut(s)	5, 204
BtsI	GCAGTG	1 cut(s)	168
BtsIMutI	CAGTG	1 cut(s)	168
Cac8I	GCNNGC	1 cut(s)	7
Cfr10I	RCCGGY	2 cut(s)	5, 41
CviJI	RGCY	5 cut(s)	5, 41, 137, 185, 204
CviKI_1	RGCY	5 cut(s)	5, 41, 137, 185, 204
EaeI	YGGCCR	1 cut(s)	3
FaqI	GGGAC	1 cut(s)	47
FspBI	CTAG	1 cut(s)	174
HaeIII	GGCC	2 cut(s)	5, 204
HapII	CCGG	2 cut(s)	6, 42
HinfI	GANTC	1 cut(s)	15
HpaII	CCGG	2 cut(s)	6, 42
HphI	GGTGA	1 cut(s)	158
Hpy188III	TCNNGA	3 cut(s)	47, 112, 174
HpyAV	CCTTC	1 cut(s)	108
HpyCH4III	ACNGT	1 cut(s)	54
HpyCH4V	TGCA	1 cut(s)	25
KroI	GCCGGC	1 cut(s)	5
KroNI	GCCGGC	1 cut(s)	7
LpnPI	CCDG	6 cut(s)	16, 19, 32, 55, 107, 167
MaeI	CTAG	1 cut(s)	174
MaeIII	GTNAC	1 cut(s)	163
MboII	GAAGA	1 cut(s)	127
MluCI	AATT	1 cut(s)	105
MnlI	CCTC	5 cut(s)	65, 76, 105, 170, 215
MroNI	GCCGGC	1 cut(s)	5
MseI	TTAA	1 cut(s)	217
MspI	CCGG	2 cut(s)	6, 42
NaeI	GCCGGC	1 cut(s)	7
NgoMIV	GCCGGC	1 cut(s)	5
NmuCI	GTSAC	1 cut(s)	163
PdiI	GCCGGC	1 cut(s)	7
PfeI	GAWTC	1 cut(s)	15
SaqAI	TTAA	1 cut(s)	217
SetI	ASST	1 cut(s)	181
SmlI	CTYRAG	1 cut(s)	206
SmoI	CTYRAG	1 cut(s)	206
Sse9I	AATT	1 cut(s)	105
SspMI	CTAG	1 cut(s)	174
TaaI	ACNGT	1 cut(s)	54
TasI	AATT	1 cut(s)	105
TfiI	GAWTC	1 cut(s)	15
Tru1I	TTAA	1 cut(s)	217
Tru9I	TTAA	1 cut(s)	217
TscAI	CASTG	1 cut(s)	168
TseFI	GTSAC	1 cut(s)	163
Tsp45I	GTSAC	1 cut(s)	163
TspRI	CASTG	1 cut(s)	168
XbaI	TCTAGA	1 cut(s)	173
XspI	CTAG	1 cut(s)	174

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.