Rroxscaffold_7G00208980

PI-PLC X domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0020571
Physical Location & Seq
Forward (+)
59171853 .. 59176164
4312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00208980.1

Sequence Viewer

Length: 438 bp
ATGCCAAAAGATGGTAAAGATTGGTCTACAGTTATGAATATGATTGAGGCAAACCAGGTTTGCTGGTTTTCACTTATAGACCGGAAAAGGAGGCTGCTGATCGAAGGAATAGCTTATCAGTGGAACTATATGGTGGAAAACCAATGCAAATTAATGCTATACTTACATATCATGACTTGCGGTAACCGTGGTGAATGGTCTCTGATGATGAACAAAACGAAGTCAATCATTTTAATGAACTACTTTTCTAGTAACCCTAATATCATTCGATCTTGCAATGATAATCCAGATCCGTTGCTAGACATGATCAAAACCTGCCAGGTAGCCACGGCTAATCAATGGCCTAATTTCGTTGCCGCTGACTTTTTCACCGACCTGCATACTTTTTGCAAGGTGAGAGATCATTGGACTATTGGAGTAAGAAATAGAAAACGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

145

Amino Acids

17.16

Weight (kDa)

8.97

Isoelectric Point (pI)

35.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PI-PLC_cat PF26178 1 - 124 3.1e-34 PI-PLC-like catalytic domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020571)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0257801
rosa_laevigata RLG00000014728
rosa_roxburghii Rroxscaffold_7G00208980
rosa_samantha Rh6AG084700 Rh6CG074100 Rh6DG071000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 323, 384
AccB7I CCANNNNNTGG 1 cut(s) 11
AccI GTMKAC 1 cut(s) 26
AciI CCGC 2 cut(s) 180, 357
AclWI GGATC 1 cut(s) 284
AfiI CCNNNNNNNGG 1 cut(s) 11
AjnI CCWGG 2 cut(s) 54, 318
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
Alw26I GTCTC 1 cut(s) 204
AlwI GGATC 1 cut(s) 284
AoxI GGCC 1 cut(s) 341
ApeKI GCWGC 1 cut(s) 94
AseI ATTAAT 1 cut(s) 152
AsuHPI GGTGA 3 cut(s) 203, 361, 406
BbvI GCAGC 1 cut(s) 81
BccI CCATC 1 cut(s) 5
BceAI ACGGC 1 cut(s) 345
BciT130I CCWGG 2 cut(s) 56, 320
BclI TGATCA 1 cut(s) 306
BcoDI GTCTC 1 cut(s) 204
BfaI CTAG 2 cut(s) 249, 299
BfmI CTRYAG 1 cut(s) 27
BfuAI ACCTGC 2 cut(s) 323, 384
BisI GCNGC 2 cut(s) 95, 357
BlsI GCNGC 2 cut(s) 96, 358
Bme1390I CCNGG 2 cut(s) 56, 320
BmrFI CCNGG 2 cut(s) 56, 320
BsaI GGTCTC 1 cut(s) 204
BsaJI CCNNGG 2 cut(s) 187, 327
BsaWI WCCGGW 1 cut(s) 81
Bsc4I CCNNNNNNNGG 1 cut(s) 11
Bse3DI GCAATG 1 cut(s) 283
BseBI CCWGG 2 cut(s) 56, 320
BseDI CCNNGG 2 cut(s) 187, 327
BseLI CCNNNNNNNGG 1 cut(s) 11
BseMI GCAATG 1 cut(s) 283
BseXI GCAGC 1 cut(s) 81
BshFI GGCC 1 cut(s) 343
BsiSI CCGG 1 cut(s) 82
BslI CCNNNNNNNGG 1 cut(s) 11
BsmAI GTCTC 1 cut(s) 204
BsnI GGCC 1 cut(s) 343
Bso31I GGTCTC 1 cut(s) 204
Bsp143I GATC 5 cut(s) 99, 269, 289, 306, 400
BspACI CCGC 2 cut(s) 180, 357
BspANI GGCC 1 cut(s) 343
BspHI TCATGA 1 cut(s) 171
BspMI ACCTGC 2 cut(s) 323, 384
BspPI GGATC 1 cut(s) 284
BspTNI GGTCTC 1 cut(s) 204
BsrDI GCAATG 1 cut(s) 283
BssECI CCNNGG 2 cut(s) 187, 327
BssMI GATC 5 cut(s) 99, 269, 289, 306, 400
Bst2UI CCWGG 2 cut(s) 56, 320
Bst4CI ACNGT 2 cut(s) 31, 188
BstDSI CCRYGG 2 cut(s) 187, 327
BstEII GGTNACC 1 cut(s) 182
BstKTI GATC 5 cut(s) 102, 272, 292, 309, 403
BstMAI GTCTC 1 cut(s) 204
BstMBI GATC 5 cut(s) 99, 269, 289, 306, 400
BstNI CCWGG 2 cut(s) 56, 320
BstPI GGTNACC 1 cut(s) 182
BstSCI CCNGG 2 cut(s) 54, 318
BstSFI CTRYAG 1 cut(s) 27
BstV1I GCAGC 1 cut(s) 81
BstX2I RGATCY 1 cut(s) 289
BstYI RGATCY 1 cut(s) 289
BsuRI GGCC 1 cut(s) 343
BtgI CCRYGG 2 cut(s) 187, 327
BtsIMutI CAGTG 1 cut(s) 125
BveI ACCTGC 2 cut(s) 323, 384
CciI TCATGA 1 cut(s) 171
CsiI ACCWGGT 1 cut(s) 54
CviAII CATG 2 cut(s) 172, 304
CviJI RGCY 5 cut(s) 94, 113, 326, 332, 343
CviKI_1 RGCY 5 cut(s) 94, 113, 326, 332, 343
DpnI GATC 5 cut(s) 101, 271, 291, 308, 402
DpnII GATC 5 cut(s) 99, 269, 289, 306, 400
Eco31I GGTCTC 1 cut(s) 204
Eco91I GGTNACC 1 cut(s) 182
EcoO65I GGTNACC 1 cut(s) 182
EcoRII CCWGG 2 cut(s) 54, 318
FaeI CATG 2 cut(s) 175, 307
FatI CATG 2 cut(s) 171, 303
FbaI TGATCA 1 cut(s) 306
FblI GTMKAC 1 cut(s) 26
Fnu4HI GCNGC 2 cut(s) 95, 357
Fsp4HI GCNGC 2 cut(s) 95, 357
FspBI CTAG 2 cut(s) 249, 299
GluI GCNGC 2 cut(s) 95, 357
HaeIII GGCC 1 cut(s) 343
HapII CCGG 1 cut(s) 82
Hin1II CATG 2 cut(s) 175, 307
HpaII CCGG 1 cut(s) 82
HphI GGTGA 3 cut(s) 203, 361, 406
Hpy166II GTNNAC 1 cut(s) 27
Hpy188I TCNGA 1 cut(s) 204
Hpy188III TCNNGA 2 cut(s) 172, 287
Hpy8I GTNNAC 1 cut(s) 27
HpyAV CCTTC 1 cut(s) 98
HpyCH4III ACNGT 2 cut(s) 31, 188
HpyCH4V TGCA 4 cut(s) 147, 276, 379, 390
Hsp92II CATG 2 cut(s) 175, 307
Ksp22I TGATCA 1 cut(s) 306
Kzo9I GATC 5 cut(s) 99, 269, 289, 306, 400
LpnPI CCDG 9 cut(s) 41, 49, 68, 95, 300, 305, 328, 332, 389
Lsp1109I GCAGC 1 cut(s) 81
MabI ACCWGGT 1 cut(s) 54
MaeI CTAG 2 cut(s) 249, 299
MaeIII GTNAC 2 cut(s) 182, 251
MalI GATC 5 cut(s) 101, 271, 291, 308, 402
MboI GATC 5 cut(s) 99, 269, 289, 306, 400
MflI RGATCY 1 cut(s) 289
MluCI AATT 2 cut(s) 149, 346
MnlI CCTC 2 cut(s) 40, 84
MseI TTAA 2 cut(s) 152, 233
MslI CAYNNNNRTG 1 cut(s) 233
MspA1I CMGCKG 1 cut(s) 359
MspI CCGG 1 cut(s) 82
MspR9I CCNGG 2 cut(s) 56, 320
MvaI CCWGG 2 cut(s) 56, 320
NdeII GATC 5 cut(s) 99, 269, 289, 306, 400
NlaIII CATG 2 cut(s) 175, 307
PagI TCATGA 1 cut(s) 171
PflMI CCANNNNNTGG 1 cut(s) 11
PkrI GCNGC 2 cut(s) 96, 358
PshBI ATTAAT 1 cut(s) 152
Psp6I CCWGG 2 cut(s) 54, 318
PspEI GGTNACC 1 cut(s) 182
PspGI CCWGG 2 cut(s) 54, 318
PsuI RGATCY 1 cut(s) 289
RseI CAYNNNNRTG 1 cut(s) 233
SaqAI TTAA 2 cut(s) 152, 233
SatI GCNGC 2 cut(s) 95, 357
Sau3AI GATC 5 cut(s) 99, 269, 289, 306, 400
ScrFI CCNGG 2 cut(s) 56, 320
SetI ASST 6 cut(s) 60, 115, 317, 324, 378, 396
SexAI ACCWGGT 1 cut(s) 54
SfcI CTRYAG 1 cut(s) 27
SmiMI CAYNNNNRTG 1 cut(s) 233
Sse9I AATT 2 cut(s) 149, 346
SsiI CCGC 2 cut(s) 180, 357
SspMI CTAG 2 cut(s) 249, 299
StyD4I CCNGG 2 cut(s) 54, 318
TaaI ACNGT 2 cut(s) 31, 188
TaqI TCGA 2 cut(s) 102, 268
TasI AATT 2 cut(s) 149, 346
TauI GCSGC 1 cut(s) 359
Tru1I TTAA 2 cut(s) 152, 233
Tru9I TTAA 2 cut(s) 152, 233
TscAI CASTG 1 cut(s) 125
TseI GCWGC 1 cut(s) 94
TspDTI ATGAA 3 cut(s) 50, 224, 251
TspGWI ACGGA 1 cut(s) 282
TspRI CASTG 1 cut(s) 125
Van91I CCANNNNNTGG 1 cut(s) 11
VspI ATTAAT 1 cut(s) 152
XmiI GTMKAC 1 cut(s) 26
XspI CTAG 2 cut(s) 249, 299
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.