Rh6AG084700

PI-PLC X domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0020571
Physical Location & Seq
Reverse (-)
12756571 .. 12756849
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG084700.1

Sequence Viewer

Length: 279 bp
ATGGAGATAATTTTGTTTGCAGATGGGGACAATGGGATGAAAGCTGGGACTTGCGGTAACCGTGGTGAATCGTCTCTGATGATGAACAAAACGAAGTCAATCATTTTAATGAACTACTTTTCTAGTAACCCTAATATCATTCGATCTTGCAATGATAATCCAGATCCGTTGCTAGACATGATCAAAACCTGCCAGGTAGCCACGGCTAATCAATGGCCTAATTTCGTTGCCTCTGACTTTTACACCGAAAATGCAACACATATCAATGCGACAATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

10.15

Weight (kDa)

4.75

Isoelectric Point (pI)

33.87

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PI-PLC_cat PF26178 8 - 84 1.5e-26 PI-PLC-like catalytic domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020571)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr6g0257801
rosa_laevigata RLG00000014728
rosa_roxburghii Rroxscaffold_7G00208980
rosa_samantha Rh6AG084700 Rh6CG074100 Rh6DG071000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 197
AciI CCGC 1 cut(s) 54
AclWI GGATC 1 cut(s) 158
AjnI CCWGG 1 cut(s) 192
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
Alw26I GTCTC 1 cut(s) 78
AlwI GGATC 1 cut(s) 158
AoxI GGCC 1 cut(s) 215
AsuHPI GGTGA 1 cut(s) 77
BccI CCATC 1 cut(s) 17
BceAI ACGGC 1 cut(s) 219
BciT130I CCWGG 1 cut(s) 194
BclI TGATCA 1 cut(s) 180
BcoDI GTCTC 1 cut(s) 78
BfaI CTAG 2 cut(s) 123, 173
BfuAI ACCTGC 1 cut(s) 197
Bme1390I CCNGG 1 cut(s) 194
BmrFI CCNGG 1 cut(s) 194
BsaJI CCNNGG 2 cut(s) 61, 201
Bse3DI GCAATG 1 cut(s) 157
BseBI CCWGG 1 cut(s) 194
BseDI CCNNGG 2 cut(s) 61, 201
BseGI GGATG 1 cut(s) 42
BseMI GCAATG 1 cut(s) 157
BseYI CCCAGC 1 cut(s) 44
BshFI GGCC 1 cut(s) 217
BslFI GGGAC 2 cut(s) 41, 61
BsmAI GTCTC 1 cut(s) 78
BsmBI CGTCTC 1 cut(s) 78
BsmFI GGGAC 2 cut(s) 41, 61
BsnI GGCC 1 cut(s) 217
Bsp143I GATC 3 cut(s) 143, 163, 180
BspACI CCGC 1 cut(s) 54
BspANI GGCC 1 cut(s) 217
BspMI ACCTGC 1 cut(s) 197
BspPI GGATC 1 cut(s) 158
BsrDI GCAATG 1 cut(s) 157
BssECI CCNNGG 2 cut(s) 61, 201
BssMI GATC 3 cut(s) 143, 163, 180
Bst2UI CCWGG 1 cut(s) 194
Bst4CI ACNGT 1 cut(s) 62
BstDSI CCRYGG 2 cut(s) 61, 201
BstEII GGTNACC 1 cut(s) 56
BstF5I GGATG 1 cut(s) 42
BstKTI GATC 3 cut(s) 146, 166, 183
BstMAI GTCTC 1 cut(s) 78
BstMBI GATC 3 cut(s) 143, 163, 180
BstNI CCWGG 1 cut(s) 194
BstPI GGTNACC 1 cut(s) 56
BstSCI CCNGG 1 cut(s) 192
BstX2I RGATCY 1 cut(s) 163
BstYI RGATCY 1 cut(s) 163
BsuRI GGCC 1 cut(s) 217
BtgI CCRYGG 2 cut(s) 61, 201
BtsCI GGATG 1 cut(s) 42
BveI ACCTGC 1 cut(s) 197
CviAII CATG 1 cut(s) 178
CviJI RGCY 4 cut(s) 44, 200, 206, 217
CviKI_1 RGCY 4 cut(s) 44, 200, 206, 217
DpnI GATC 3 cut(s) 145, 165, 182
DpnII GATC 3 cut(s) 143, 163, 180
Eco91I GGTNACC 1 cut(s) 56
EcoO65I GGTNACC 1 cut(s) 56
EcoRII CCWGG 1 cut(s) 192
Esp3I CGTCTC 1 cut(s) 78
FaeI CATG 1 cut(s) 181
FaiI YATR 2 cut(s) 179, 261
FaqI GGGAC 2 cut(s) 41, 61
FatI CATG 1 cut(s) 177
FbaI TGATCA 1 cut(s) 180
FokI GGATG 1 cut(s) 49
FspBI CTAG 2 cut(s) 123, 173
GsaI CCCAGC 1 cut(s) 48
HaeIII GGCC 1 cut(s) 217
Hin1II CATG 1 cut(s) 181
HinfI GANTC 1 cut(s) 68
HphI GGTGA 1 cut(s) 77
Hpy188I TCNGA 2 cut(s) 78, 235
Hpy188III TCNNGA 1 cut(s) 161
HpyCH4III ACNGT 1 cut(s) 62
HpyCH4V TGCA 3 cut(s) 20, 150, 254
Hsp92II CATG 1 cut(s) 181
Ksp22I TGATCA 1 cut(s) 180
Kzo9I GATC 3 cut(s) 143, 163, 180
LpnPI CCDG 5 cut(s) 30, 174, 179, 202, 206
MaeI CTAG 2 cut(s) 123, 173
MaeIII GTNAC 2 cut(s) 56, 125
MalI GATC 3 cut(s) 145, 165, 182
MboI GATC 3 cut(s) 143, 163, 180
MflI RGATCY 1 cut(s) 163
MluCI AATT 3 cut(s) 9, 220, 273
MnlI CCTC 1 cut(s) 241
MseI TTAA 2 cut(s) 107, 277
MslI CAYNNNNRTG 2 cut(s) 107, 264
MspR9I CCNGG 1 cut(s) 194
MvaI CCWGG 1 cut(s) 194
NdeII GATC 3 cut(s) 143, 163, 180
NlaIII CATG 1 cut(s) 181
PfeI GAWTC 1 cut(s) 68
Psp6I CCWGG 1 cut(s) 192
PspEI GGTNACC 1 cut(s) 56
PspFI CCCAGC 1 cut(s) 44
PspGI CCWGG 1 cut(s) 192
PsuI RGATCY 1 cut(s) 163
RseI CAYNNNNRTG 2 cut(s) 107, 264
SaqAI TTAA 2 cut(s) 107, 277
Sau3AI GATC 3 cut(s) 143, 163, 180
ScrFI CCNGG 1 cut(s) 194
SetI ASST 3 cut(s) 46, 191, 198
SmiMI CAYNNNNRTG 2 cut(s) 107, 264
Sse9I AATT 3 cut(s) 9, 220, 273
SsiI CCGC 1 cut(s) 54
SspMI CTAG 2 cut(s) 123, 173
StyD4I CCNGG 1 cut(s) 192
TaaI ACNGT 1 cut(s) 62
TaqI TCGA 1 cut(s) 142
TasI AATT 3 cut(s) 9, 220, 273
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 2 cut(s) 107, 277
Tru9I TTAA 2 cut(s) 107, 277
TspDTI ATGAA 3 cut(s) 53, 98, 125
TspGWI ACGGA 1 cut(s) 156
XspI CTAG 2 cut(s) 123, 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.