Rorug02G0268200

Protein cornichon homolog 4-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
28305538 .. 28305837
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0268200.1

Sequence Viewer

Length: 300 bp
ATGGCTTTTCTTGTAGGCTGTCTTCTTGCCTTTGCAGTTATCCTGAATGGTGAAGCAAAAGCCGTGCCATCTAATATAAGCACTGGCTCTTCTTTAACACCCACTTCCAACTCCTCGTGGTTGTCAAGCTCCGGTCTGTATGCCTTCGGTTTTTATAAGCAAGGCAATGGCTATGCTGTGGGGATAGTGCTTGCTGGAATCCCTGAAAAGACTGTAGTCTGGACTGCAAAACGCGATGGCCCCCTGGTCTCCAACAATGCCACCTTGCTCTTTACATCTGGCGGGCTTTCGTTGCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

10.17

Weight (kDa)

8.93

Isoelectric Point (pI)

39.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020526)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 156
AccII CGCG 1 cut(s) 234
AciI CCGC 1 cut(s) 282
AjnI CCWGG 1 cut(s) 243
AluBI AGCT 1 cut(s) 129
AluI AGCT 1 cut(s) 129
Alw26I GTCTC 1 cut(s) 253
AoxI GGCC 1 cut(s) 238
AspS9I GGNCC 1 cut(s) 239
AsuHPI GGTGA 1 cut(s) 62
BarI GAAGNNNNNNTAC 1 cut(s) 38
BauI CACGAG 1 cut(s) 115
BbsI GAAGAC 1 cut(s) 14
BccI CCATC 2 cut(s) 76, 230
BceAI ACGGC 1 cut(s) 47
BciT130I CCWGG 1 cut(s) 245
BcoDI GTCTC 1 cut(s) 253
BfmI CTRYAG 1 cut(s) 213
Bme1390I CCNGG 1 cut(s) 245
BmgT120I GGNCC 1 cut(s) 239
BmiI GGNNCC 1 cut(s) 241
BmrFI CCNGG 1 cut(s) 245
BoxI GACNNNNGTC 1 cut(s) 215
BpiI GAAGAC 1 cut(s) 14
BsaI GGTCTC 1 cut(s) 253
BsaJI CCNNGG 1 cut(s) 243
BsaWI WCCGGW 1 cut(s) 131
Bse1I ACTGG 1 cut(s) 88
Bse3DI GCAATG 1 cut(s) 172
BseBI CCWGG 1 cut(s) 245
BseDI CCNNGG 1 cut(s) 243
BseMI GCAATG 1 cut(s) 172
BseNI ACTGG 1 cut(s) 88
BseRI GAGGAG 1 cut(s) 103
Bsh1236I CGCG 1 cut(s) 234
BshFI GGCC 1 cut(s) 240
BsiSI CCGG 1 cut(s) 132
BsmAI GTCTC 1 cut(s) 253
BsnI GGCC 1 cut(s) 240
Bso31I GGTCTC 1 cut(s) 253
BspACI CCGC 1 cut(s) 282
BspANI GGCC 1 cut(s) 240
BspFNI CGCG 1 cut(s) 234
BspLI GGNNCC 1 cut(s) 241
BspQI GCTCTTC 1 cut(s) 94
BspTNI GGTCTC 1 cut(s) 253
BsrDI GCAATG 1 cut(s) 172
BsrI ACTGG 1 cut(s) 88
BssECI CCNNGG 1 cut(s) 243
BssSI CACGAG 1 cut(s) 115
Bst2BI CACGAG 1 cut(s) 115
Bst2UI CCWGG 1 cut(s) 245
Bst4CI ACNGT 1 cut(s) 214
Bst6I CTCTTC 1 cut(s) 94
BstC8I GCNNGC 2 cut(s) 192, 284
BstFNI CGCG 1 cut(s) 234
BstMAI GTCTC 1 cut(s) 253
BstMWI GCNNNNNNNGC 1 cut(s) 292
BstNI CCWGG 1 cut(s) 245
BstPAI GACNNNNGTC 1 cut(s) 215
BstSCI CCNGG 1 cut(s) 243
BstSFI CTRYAG 1 cut(s) 213
BstUI CGCG 1 cut(s) 234
BstV2I GAAGAC 1 cut(s) 14
BsuRI GGCC 1 cut(s) 240
BtgZI GCGATG 1 cut(s) 249
BtsIMutI CAGTG 1 cut(s) 81
Cac8I GCNNGC 2 cut(s) 192, 284
Cfr13I GGNCC 1 cut(s) 239
CviJI RGCY 8 cut(s) 5, 18, 62, 87, 129, 171, 240, 286
CviKI_1 RGCY 8 cut(s) 5, 18, 62, 87, 129, 171, 240, 286
Eam1104I CTCTTC 1 cut(s) 94
EarI CTCTTC 1 cut(s) 94
Eco31I GGTCTC 1 cut(s) 253
EcoRII CCWGG 1 cut(s) 243
FaiI YATR 4 cut(s) 77, 141, 156, 174
FauI CCCGC 1 cut(s) 275
HaeIII GGCC 1 cut(s) 240
HapII CCGG 1 cut(s) 132
HinfI GANTC 1 cut(s) 198
HpaII CCGG 1 cut(s) 132
HphI GGTGA 1 cut(s) 62
Hpy188III TCNNGA 2 cut(s) 43, 220
HpyAV CCTTC 1 cut(s) 154
HpyCH4III ACNGT 1 cut(s) 214
HpyCH4V TGCA 3 cut(s) 35, 227, 295
HpyF10VI GCNNNNNNNGC 1 cut(s) 292
LguI GCTCTTC 1 cut(s) 94
LmnI GCTCC 1 cut(s) 134
LpnPI CCDG 9 cut(s) 56, 69, 145, 180, 205, 216, 230, 257, 264
MboII GAAGA 2 cut(s) 14, 81
MmeI TCCRAC 2 cut(s) 132, 276
MnlI CCTC 1 cut(s) 124
MseI TTAA 1 cut(s) 95
MspI CCGG 1 cut(s) 132
MspR9I CCNGG 1 cut(s) 245
MvaI CCWGG 1 cut(s) 245
MvnI CGCG 1 cut(s) 234
MwoI GCNNNNNNNGC 1 cut(s) 292
NlaIV GGNNCC 1 cut(s) 241
PciSI GCTCTTC 1 cut(s) 94
PfeI GAWTC 1 cut(s) 198
PshAI GACNNNNGTC 1 cut(s) 215
PsiI TTATAA 1 cut(s) 156
Psp6I CCWGG 1 cut(s) 243
PspGI CCWGG 1 cut(s) 243
PspN4I GGNNCC 1 cut(s) 241
PspPI GGNCC 1 cut(s) 239
SapI GCTCTTC 1 cut(s) 94
SaqAI TTAA 1 cut(s) 95
Sau96I GGNCC 1 cut(s) 239
ScrFI CCNGG 1 cut(s) 245
SetI ASST 2 cut(s) 131, 266
SfcI CTRYAG 1 cut(s) 213
SsiI CCGC 1 cut(s) 282
StyD4I CCNGG 1 cut(s) 243
TaaI ACNGT 1 cut(s) 214
TfiI GAWTC 1 cut(s) 198
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TscAI CASTG 1 cut(s) 88
TspRI CASTG 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.