Rorug02G0495200

Catalyzes the radical-mediated insertion of two sulfur atoms into the C-6 and C-8 positions of the octanoyl moiety bound to the lipoyl domains of lipoate-dependent enzymes, thereby converting the octanoylated domains into lipoylated derivatives

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
62467748 .. 62469250
1503 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0495200.1

Sequence Viewer

Length: 201 bp
ATGCATTCTCTGGCTCACACCCACTTAACAGTAATTGGCTCAGATTCTGTATGCAAGCAGGTCTGCCATTACCCTGATCCTGTAACAAGGTTTAACATTGCACCAGACTTGATGAATCAAGCAAAAGATTATTTGAACAAAACTATATATGAGAGGTTTTGCCGCAAAGAAGGATGTGTGTTGAGCATTAAGTTGCGATAA

Protein Analysis

66

Amino Acids

7.61

Weight (kDa)

8.8

Isoelectric Point (pI)

44.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012460)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 49
AciI CCGC 1 cut(s) 163
AclWI GGATC 1 cut(s) 71
AgsI TTSAA 1 cut(s) 136
AlwI GGATC 1 cut(s) 71
AlwNI CAGNNNCTG 1 cut(s) 47
BfuAI ACCTGC 1 cut(s) 49
BisI GCNGC 1 cut(s) 163
BlsI GCNGC 1 cut(s) 164
Bse3DI GCAATG 1 cut(s) 96
BseGI GGATG 1 cut(s) 179
BseMI GCAATG 1 cut(s) 96
BseMII CTCAG 1 cut(s) 54
BsmI GAATGC 1 cut(s) 4
Bsp143I GATC 1 cut(s) 76
BspACI CCGC 1 cut(s) 163
BspCNI CTCAG 1 cut(s) 53
BspMI ACCTGC 1 cut(s) 49
BspPI GGATC 1 cut(s) 71
BsrDI GCAATG 1 cut(s) 96
BssMI GATC 1 cut(s) 76
Bst4CI ACNGT 1 cut(s) 31
BstC8I GCNNGC 1 cut(s) 56
BstDEI CTNAG 1 cut(s) 40
BstF5I GGATG 1 cut(s) 179
BstKTI GATC 1 cut(s) 79
BstMBI GATC 1 cut(s) 76
BtsCI GGATG 1 cut(s) 179
BveI ACCTGC 1 cut(s) 49
Cac8I GCNNGC 1 cut(s) 56
CaiI CAGNNNCTG 1 cut(s) 47
CviJI RGCY 2 cut(s) 14, 39
CviKI_1 RGCY 2 cut(s) 14, 39
DdeI CTNAG 1 cut(s) 40
DpnI GATC 1 cut(s) 78
DpnII GATC 1 cut(s) 76
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 4 cut(s) 52, 146, 148, 150
Fnu4HI GCNGC 1 cut(s) 163
FokI GGATG 1 cut(s) 186
Fsp4HI GCNGC 1 cut(s) 163
GluI GCNGC 1 cut(s) 163
HinfI GANTC 2 cut(s) 44, 115
Hpy188I TCNGA 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 164
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4V TGCA 3 cut(s) 4, 54, 101
HpyF3I CTNAG 1 cut(s) 40
Kzo9I GATC 1 cut(s) 76
LpnPI CCDG 4 cut(s) 44, 87, 93, 117
MaeIII GTNAC 1 cut(s) 82
MalI GATC 1 cut(s) 78
MboI GATC 1 cut(s) 76
MluCI AATT 1 cut(s) 33
MnlI CCTC 1 cut(s) 147
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 3 cut(s) 26, 93, 189
Mva1269I GAATGC 1 cut(s) 4
NdeII GATC 1 cut(s) 76
NsiI ATGCAT 1 cut(s) 6
PctI GAATGC 1 cut(s) 4
PfeI GAWTC 2 cut(s) 44, 115
PkrI GCNGC 1 cut(s) 164
PstNI CAGNNNCTG 1 cut(s) 47
SaqAI TTAA 3 cut(s) 26, 93, 189
SatI GCNGC 1 cut(s) 163
Sau3AI GATC 1 cut(s) 76
SetI ASST 3 cut(s) 63, 92, 158
SgeI CNNG 9 cut(s) 23, 67, 71, 86, 92, 99, 116, 121, 131
Sse9I AATT 1 cut(s) 33
SsiI CCGC 1 cut(s) 163
TaaI ACNGT 1 cut(s) 31
TasI AATT 1 cut(s) 33
TauI GCSGC 1 cut(s) 165
TfiI GAWTC 2 cut(s) 44, 115
Tru1I TTAA 3 cut(s) 26, 93, 189
Tru9I TTAA 3 cut(s) 26, 93, 189
TspDTI ATGAA 1 cut(s) 128
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.