Rorug03G0089900

exocyst complex component

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
7001113 .. 7001499
387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0089900.1

Sequence Viewer

Length: 387 bp
ATGATGGAGATCTACTCCAAGGCTGACAGGTCCAAGGAGGCTCTCAGGGTGTTCCAGAGGATGATATCCCTTGGTGTTGCTCCCAACGCATACACCTATAGTGTTCTCATCAAGGCACTCACTAAAGACCCCAACTTCCTTGATGATGCCAAGCAGTATGTGCTGGAAATGATGGGGAATGGAATGCAACCCACTGCCAAGACCTACACCACTTTGTTTTATGCTTTTGCCCAGCTGGGGAAGGATAAGTTGAAGGAGGTTAAGGAGTTTGTGAAGCAGATGAAAGCCAGGGGTTTTGTAGCTAACAAGAAAGCTGTGAAGGAAGTTCTGAAGGGTAAAAAAGCACCTATTGCTAGAATGGTCATCAACATTCTCTTTGCTGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

128

Amino Acids

14.52

Weight (kDa)

9.85

Isoelectric Point (pI)

21.89

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 1 - 42 5.3e-11 PPR repeat family
TPR_24 PF23276 1 - 57 2.4e-06 Fungal tetratrico peptide repeats
PPR_long PF17177 10 - 110 6.5e-08 Pentacotripeptide-repeat region of PRORP
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 350
AfiI CCNNNNNNNGG 1 cut(s) 237
AgsI TTSAA 1 cut(s) 253
AjnI CCWGG 1 cut(s) 287
AluBI AGCT 3 cut(s) 235, 302, 314
AluI AGCT 3 cut(s) 235, 302, 314
AspS9I GGNCC 1 cut(s) 30
AvaII GGWCC 1 cut(s) 30
BccI CCATC 1 cut(s) 166
BciT130I CCWGG 1 cut(s) 289
BfaI CTAG 1 cut(s) 354
BfmI CTRYAG 1 cut(s) 97
BglII AGATCT 1 cut(s) 9
Bme1390I CCNGG 1 cut(s) 289
Bme18I GGWCC 1 cut(s) 30
BmgT120I GGNCC 1 cut(s) 30
BmrFI CCNGG 1 cut(s) 289
BmsI GCATC 1 cut(s) 136
BplI GAGNNNNNCTC 1 cut(s) 31
BsaBI GATNNNNATC 1 cut(s) 8
BsaJI CCNNGG 4 cut(s) 18, 33, 70, 288
Bsc4I CCNNNNNNNGG 1 cut(s) 237
Bse8I GATNNNNATC 1 cut(s) 8
BseBI CCWGG 1 cut(s) 289
BseDI CCNNGG 4 cut(s) 18, 33, 70, 288
BseGI GGATG 1 cut(s) 66
BseJI GATNNNNATC 1 cut(s) 8
BseLI CCNNNNNNNGG 1 cut(s) 237
BseMII CTCAG 2 cut(s) 58, 372
BseYI CCCAGC 2 cut(s) 231, 235
BslI CCNNNNNNNGG 1 cut(s) 237
BsmI GAATGC 1 cut(s) 189
Bsp143I GATC 1 cut(s) 9
BspCNI CTCAG 2 cut(s) 57, 373
BssECI CCNNGG 4 cut(s) 18, 33, 70, 288
BssMI GATC 1 cut(s) 9
BssT1I CCWWGG 3 cut(s) 18, 33, 70
Bst2UI CCWGG 1 cut(s) 289
BstAPI GCANNNNNTGC 2 cut(s) 160, 350
BstDEI CTNAG 2 cut(s) 44, 381
BstF5I GGATG 1 cut(s) 66
BstKTI GATC 1 cut(s) 12
BstMBI GATC 1 cut(s) 9
BstMWI GCNNNNNNNGC 3 cut(s) 86, 160, 350
BstNI CCWGG 1 cut(s) 289
BstSCI CCNGG 1 cut(s) 287
BstSFI CTRYAG 1 cut(s) 97
BstX2I RGATCY 1 cut(s) 9
BstYI RGATCY 1 cut(s) 9
BtsCI GGATG 1 cut(s) 66
BtsI GCAGTG 1 cut(s) 192
BtsIMutI CAGTG 1 cut(s) 192
Cfr13I GGNCC 1 cut(s) 30
CviJI RGCY 6 cut(s) 23, 41, 235, 287, 302, 314
CviKI_1 RGCY 6 cut(s) 23, 41, 235, 287, 302, 314
DdeI CTNAG 2 cut(s) 44, 381
DpnI GATC 1 cut(s) 11
DpnII GATC 1 cut(s) 9
Eco130I CCWWGG 3 cut(s) 18, 33, 70
Eco32I GATATC 1 cut(s) 66
Eco47I GGWCC 1 cut(s) 30
Eco57I CTGAAG 1 cut(s) 350
EcoRII CCWGG 1 cut(s) 287
EcoRV GATATC 1 cut(s) 66
EcoT14I CCWWGG 3 cut(s) 18, 33, 70
ErhI CCWWGG 3 cut(s) 18, 33, 70
FaiI YATR 4 cut(s) 91, 99, 159, 222
FokI GGATG 1 cut(s) 73
FspBI CTAG 1 cut(s) 354
GsaI CCCAGC 2 cut(s) 235, 239
Hpy188I TCNGA 1 cut(s) 330
Hpy188III TCNNGA 1 cut(s) 55
HpyAV CCTTC 4 cut(s) 235, 247, 313, 325
HpyCH4V TGCA 1 cut(s) 187
HpyF10VI GCNNNNNNNGC 3 cut(s) 86, 160, 350
HpyF3I CTNAG 2 cut(s) 44, 381
Kzo9I GATC 1 cut(s) 9
LmnI GCTCC 1 cut(s) 85
LpnPI CCDG 8 cut(s) 13, 31, 68, 149, 221, 245, 274, 301
LweI GCATC 1 cut(s) 136
MaeI CTAG 1 cut(s) 354
MalI GATC 1 cut(s) 11
MboI GATC 1 cut(s) 9
MflI RGATCY 1 cut(s) 9
MnlI CCTC 3 cut(s) 31, 51, 250
MseI TTAA 1 cut(s) 261
MspA1I CMGCKG 1 cut(s) 235
MspR9I CCNGG 1 cut(s) 289
Mva1269I GAATGC 1 cut(s) 189
MvaI CCWGG 1 cut(s) 289
MwoI GCNNNNNNNGC 3 cut(s) 86, 160, 350
NdeII GATC 1 cut(s) 9
PctI GAATGC 1 cut(s) 189
Psp6I CCWGG 1 cut(s) 287
PspFI CCCAGC 2 cut(s) 231, 235
PspGI CCWGG 1 cut(s) 287
PspPI GGNCC 1 cut(s) 30
PsuI RGATCY 1 cut(s) 9
PvuII CAGCTG 1 cut(s) 235
SaqAI TTAA 1 cut(s) 261
Sau3AI GATC 1 cut(s) 9
Sau96I GGNCC 1 cut(s) 30
ScrFI CCNGG 1 cut(s) 289
SetI ASST 8 cut(s) 32, 98, 206, 237, 261, 304, 316, 349
SfaNI GCATC 1 cut(s) 136
SfcI CTRYAG 1 cut(s) 97
SinI GGWCC 1 cut(s) 30
SspMI CTAG 1 cut(s) 354
StyD4I CCNGG 1 cut(s) 287
StyI CCWWGG 3 cut(s) 18, 33, 70
Tru1I TTAA 1 cut(s) 261
Tru9I TTAA 1 cut(s) 261
TscAI CASTG 1 cut(s) 199
TspDTI ATGAA 1 cut(s) 296
TspRI CASTG 1 cut(s) 199
VpaK11BI GGWCC 1 cut(s) 30
XspI CTAG 1 cut(s) 354
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.