Rorug03G0211600

Catalyzes conversion of folates to polyglutamate derivatives allowing concentration of folate compounds in the cell and the intracellular retention of these cofactors, which are important substrates for most of the folate-dependent enzymes that are involved in one-carbon transfer reactions involved in purine, pyrimidine and amino acid synthesis

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
18927839 .. 18929237
1399 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0211600.1

Sequence Viewer

Length: 231 bp
ATGATTGTTGTAGCCAATGAGTATCTTGATATAGTTCATATTGATCTTGGATGTGAATTTGAATATCAGGTACCATACAACAATATTGTTGTAGCCAACGTTTTAAATGATGGAAATGGGGAGCTAAACTTTGACCTGGGTAGTAGCAATCACTTCGTTTCCCATTGTGCTTTCGCTATAGAGCAGCTTTCAAATACTTTAGATCAAAGTAGTTACACTACAAAGATATAA

Protein Analysis

76

Amino Acids

8.47

Weight (kDa)

4.1

Isoelectric Point (pI)

29.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 70
AccB1I GGYRCC 1 cut(s) 70
AclI AACGTT 1 cut(s) 99
AcsI RAATTY 1 cut(s) 56
AfaI GTAC 1 cut(s) 72
AgsI TTSAA 2 cut(s) 62, 192
AjnI CCWGG 1 cut(s) 135
AluBI AGCT 2 cut(s) 124, 187
AluI AGCT 2 cut(s) 124, 187
ApeKI GCWGC 1 cut(s) 184
ApoI RAATTY 1 cut(s) 56
Asp718I GGTACC 1 cut(s) 70
BanI GGYRCC 1 cut(s) 70
BbvI GCAGC 1 cut(s) 196
BccI CCATC 1 cut(s) 104
BcgI CGANNNNNNTGC 2 cut(s) 136, 170
BciT130I CCWGG 1 cut(s) 137
BfmI CTRYAG 1 cut(s) 177
BisI GCNGC 1 cut(s) 185
BlsI GCNGC 1 cut(s) 186
Bme1390I CCNGG 1 cut(s) 137
BmiI GGNNCC 1 cut(s) 72
BmrFI CCNGG 1 cut(s) 137
BsaJI CCNNGG 1 cut(s) 136
BseBI CCWGG 1 cut(s) 137
BseDI CCNNGG 1 cut(s) 136
BseGI GGATG 1 cut(s) 56
BseXI GCAGC 1 cut(s) 196
BshNI GGYRCC 1 cut(s) 70
Bsp143I GATC 2 cut(s) 43, 202
BspLI GGNNCC 1 cut(s) 72
BspT107I GGYRCC 1 cut(s) 70
BssECI CCNNGG 1 cut(s) 136
BssMI GATC 2 cut(s) 43, 202
Bst2UI CCWGG 1 cut(s) 137
BstF5I GGATG 1 cut(s) 56
BstKTI GATC 2 cut(s) 46, 205
BstMBI GATC 2 cut(s) 43, 202
BstNI CCWGG 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 135
BstSFI CTRYAG 1 cut(s) 177
BstV1I GCAGC 1 cut(s) 196
BtsCI GGATG 1 cut(s) 56
Csp6I GTAC 1 cut(s) 71
CviJI RGCY 4 cut(s) 14, 95, 124, 187
CviKI_1 RGCY 4 cut(s) 14, 95, 124, 187
CviQI GTAC 1 cut(s) 71
DpnI GATC 2 cut(s) 45, 204
DpnII GATC 2 cut(s) 43, 202
DraI TTTAAA 1 cut(s) 105
EcoRII CCWGG 1 cut(s) 135
FaiI YATR 5 cut(s) 32, 39, 76, 179, 229
Fnu4HI GCNGC 1 cut(s) 185
FokI GGATG 1 cut(s) 63
Fsp4HI GCNGC 1 cut(s) 185
GluI GCNGC 1 cut(s) 185
Hpy188III TCNNGA 1 cut(s) 26
HpyCH4IV ACGT 1 cut(s) 99
HpySE526I ACGT 1 cut(s) 99
KpnI GGTACC 1 cut(s) 74
Kzo9I GATC 2 cut(s) 43, 202
LmnI GCTCC 1 cut(s) 121
LpnPI CCDG 3 cut(s) 53, 122, 149
Lsp1109I GCAGC 1 cut(s) 196
MaeII ACGT 1 cut(s) 99
MaeIII GTNAC 1 cut(s) 212
MalI GATC 2 cut(s) 45, 204
MboI GATC 2 cut(s) 43, 202
MluCI AATT 1 cut(s) 56
MseI TTAA 1 cut(s) 104
MspR9I CCNGG 1 cut(s) 137
MvaI CCWGG 1 cut(s) 137
NdeII GATC 2 cut(s) 43, 202
NlaIV GGNNCC 1 cut(s) 72
PkrI GCNGC 1 cut(s) 186
Psp1406I AACGTT 1 cut(s) 99
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
PspN4I GGNNCC 1 cut(s) 72
RsaI GTAC 1 cut(s) 72
RsaNI GTAC 1 cut(s) 71
SaqAI TTAA 1 cut(s) 104
SatI GCNGC 1 cut(s) 185
Sau3AI GATC 2 cut(s) 43, 202
ScrFI CCNGG 1 cut(s) 137
SetI ASST 5 cut(s) 72, 102, 126, 138, 189
SfcI CTRYAG 1 cut(s) 177
SgeI CNNG 5 cut(s) 38, 59, 80, 148, 149
Sse9I AATT 1 cut(s) 56
SspI AATATT 1 cut(s) 85
StyD4I CCNGG 1 cut(s) 135
TaiI ACGT 1 cut(s) 102
TasI AATT 1 cut(s) 56
Tru1I TTAA 1 cut(s) 104
Tru9I TTAA 1 cut(s) 104
TseI GCWGC 1 cut(s) 184
TspDTI ATGAA 1 cut(s) 26
XapI RAATTY 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.