Rorug05G0022300

beta-1,3-galactosyltransferase 20

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Forward (+)
1434241 .. 1435078
838 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0022300.1

Sequence Viewer

Length: 207 bp
ATGCACTCTGCAATTTCAATGAGTAAAACTGAAGTCTTGGATTCTGTGCTGAGTGATTTCTCAGAGGGATATTTCAGCCTTTCGTATGAGAATCGTCGAAAATTGCTTGTGCAACTTGCCAAAGAGTATGATGTTAATAGGACACAAGTTCGCGATTTGATAAAGCAGTACTTGGGACTTGAGCCTCCTGGAACTGCATGGAAGTGA

Protein Analysis

68

Amino Acids

7.85

Weight (kDa)

6.55

Isoelectric Point (pI)

43.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011074)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 153
AcuI CTGAAG 1 cut(s) 51
AfaI GTAC 1 cut(s) 170
AgsI TTSAA 1 cut(s) 18
AjnI CCWGG 1 cut(s) 187
BciT130I CCWGG 1 cut(s) 189
BmcAI AGTACT 1 cut(s) 170
Bme1390I CCNGG 1 cut(s) 189
BmrFI CCNGG 1 cut(s) 189
BpuEI CTTGAG 1 cut(s) 200
BseBI CCWGG 1 cut(s) 189
BseMII CTCAG 2 cut(s) 41, 75
Bsh1236I CGCG 1 cut(s) 153
BslFI GGGAC 1 cut(s) 189
BsmFI GGGAC 1 cut(s) 189
Bsp68I TCGCGA 1 cut(s) 153
BspCNI CTCAG 2 cut(s) 42, 74
BspFNI CGCG 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 189
BstDEI CTNAG 2 cut(s) 50, 61
BstFNI CGCG 1 cut(s) 153
BstNI CCWGG 1 cut(s) 189
BstSCI CCNGG 1 cut(s) 187
BstUI CGCG 1 cut(s) 153
BtuMI TCGCGA 1 cut(s) 153
Csp6I GTAC 1 cut(s) 169
CviAII CATG 1 cut(s) 198
CviJI RGCY 2 cut(s) 78, 184
CviKI_1 RGCY 2 cut(s) 78, 184
CviQI GTAC 1 cut(s) 169
DdeI CTNAG 2 cut(s) 50, 61
Eco57I CTGAAG 1 cut(s) 51
EcoRII CCWGG 1 cut(s) 187
FaeI CATG 1 cut(s) 201
FaiI YATR 3 cut(s) 87, 129, 199
FalI AAGNNNNNCTT 2 cut(s) 155, 187
FaqI GGGAC 1 cut(s) 189
FatI CATG 1 cut(s) 197
Hin1II CATG 1 cut(s) 201
HinfI GANTC 2 cut(s) 41, 91
Hpy188I TCNGA 1 cut(s) 64
Hpy188III TCNNGA 1 cut(s) 152
Hpy99I CGWCG 1 cut(s) 99
HpyCH4V TGCA 4 cut(s) 4, 11, 112, 197
HpyF3I CTNAG 2 cut(s) 50, 61
Hsp92II CATG 1 cut(s) 201
LpnPI CCDG 2 cut(s) 174, 201
MluCI AATT 2 cut(s) 12, 101
MnlI CCTC 2 cut(s) 58, 195
MseI TTAA 1 cut(s) 135
MslI CAYNNNNRTG 1 cut(s) 202
MspR9I CCNGG 1 cut(s) 189
MvaI CCWGG 1 cut(s) 189
MvnI CGCG 1 cut(s) 153
NlaIII CATG 1 cut(s) 201
NruI TCGCGA 1 cut(s) 153
PfeI GAWTC 2 cut(s) 41, 91
PfoI TCCNGGA 1 cut(s) 187
Psp6I CCWGG 1 cut(s) 187
PspGI CCWGG 1 cut(s) 187
RruI TCGCGA 1 cut(s) 153
RsaI GTAC 1 cut(s) 170
RsaNI GTAC 1 cut(s) 169
RseI CAYNNNNRTG 1 cut(s) 202
SaqAI TTAA 1 cut(s) 135
ScaI AGTACT 1 cut(s) 170
ScrFI CCNGG 1 cut(s) 189
SgeI CNNG 9 cut(s) 49, 119, 128, 158, 164, 184, 191, 200, 201
SmiMI CAYNNNNRTG 1 cut(s) 202
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 2 cut(s) 12, 101
StyD4I CCNGG 1 cut(s) 187
TaqI TCGA 1 cut(s) 97
TasI AATT 2 cut(s) 12, 101
TatI WGTACW 1 cut(s) 168
TfiI GAWTC 2 cut(s) 41, 91
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
ZrmI AGTACT 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.